Skip to main content
Download PDF

ADAM12 promotes clear cell renal cell carcinoma progression and triggers EMT via EGFR/ERK signaling pathway

Journal of Translational Medicine volume 21, Article number: 56 (2023) Cite this article

Abstract

Background

Clear cell renal cell carcinoma (ccRCC) is a major worldwide health problem due to its high prevalence and mortality rate. A disintegrin and metalloproteinase 12 (ADAM12) is aberrantly expressed in various cancers and plays an important role in tumor progression. However, its explicit effect and molecular mechanism in ccRCC remain unclear.

Methods

We investigated the dysregulation of ADAM12 in ccRCC through public databases and bioinformatics analyses. The expression of ADAM12 was further verified in ccRCC tissues by RT-qPCR and immunohistochemistry (IHC). The relationship between ADAM12 expression and clinicopathological characteristics was analyzed statistically. The effects of ADAM12 on the proliferation, migration and invasion of ccRCC cells were examined by in vitro and in vivo experiments.

Results

ADAM12 was significantly upregulated in ccRCC tissues and associated with poor prognosis in ccRCC patients. ADAM12 promoted ccRCC cell proliferation, migration and invasion in vitro and the growth of subcutaneous tumors in vivo. Knockdown of ADAM12 successfully suppressed its oncogenic function. Mechanistically, its overexpression induced epithelial-mesenchymal transition (EMT) by downregulating E-cadherin and upregulating N-cadherin and Snail. Moreover, ADAM12 participated in the epidermal growth factor receptor (EGFR) pathway and activated the downstream signal ERK1/2 by shedding the EGFR ligand, thereby upregulating target genes including c-Myc, enhancing cell survival and invasion ability, and promoting tumor progression, metastasis and the induction of EMT.

Conclusions

High expression of ADAM12 induced EMT and promoted cell proliferation, migration, and invasion by activating the EGFR/ERK signaling pathway in ccRCC.

Background

Renal cell carcinoma (RCC) is a fatal genitourinary malignancy that accounts for approximately 5% of cancer cases in adult men and 3% in women [1, 2]. It was estimated that there were about 431 thousand incidences and 179 thousand deaths globally in 2020 (Global Cancer Observatory). RCC is a group of malignancies with diverse histologic types, specific cytogenetic properties, and different prognoses and therapeutic responses. It includes the most common subtype, clear cell renal cell carcinoma (ccRCC), which accounts for about 75%, papillary renal cell carcinoma (pRCC), chromophobe renal cell carcinoma (chRCC), and other less common subtypes [3]. Approximately 33 to 50% of patients have metastases by the time of detection [1], and nearly one-third of patients might experience recurrence or metastasis after nephrectomy. Patients with metastatic disease only have a median survival of 13 months [4]. Although the widespread application of imaging contributes to the early detection of tumors, further exploration of the molecular mechanisms underlying RCC development is urgently needed.

A disintegrin and metalloproteinases (ADAMs) are a multidomain and multifunctional family of type I transmembrane proteins [5] that are vital for regulating cell adhesion and mediating proteolysis of a variety of cell surface receptors and signal molecule extracellular domains. Substrates for ADAMs include Notch receptor and ligand, epidermal growth factor receptor (EGFR) ligand, interleukin-6 receptor (IL-6R), tumor necrosis factor (TNF) and its receptor, E-cadherin and CD44 [6]. Owing to their abnormal expression or dysregulation, ADAMs may lead to the initiation and progression of tumors [6].

The human ADAM12 gene is located on chromosome 10q26.3 and can alternatively splice to produce a long membrane-bound variant (ADAM12-L) and a short-secreted variant (ADAM12-S) [7]. As an active metalloprotease, ADAM12 is primarily responsible for the sheddases of EGF-like ligands, including heparin-binding EGF (HB-EGF), EGF, and betacellulin (BTC), thereby activating the EGFR pathway [8, 9]. In addition, studies have suggested that the expression of ADAM12 is increased in bladder [10], colorectal [11], gastric [12], lung [13], and breast cancers [6] and leads to poor prognosis. In renal cancer, Gao et al. found an upregulation of ADAM12 in ccRCC tissues and cells. Additionally, it was found to be significantly correlated with gender, TNM stage and clinical grade of patients [14]. However, the function of ADAM12 in ccRCC and its molecular mechanism have not been clarified. Here, we demonstrate the oncogenic role of ADAM12 in ccRCC, both in vivo and in vitro. In addition, we for the first time, demonstrate that ADAM12 can further induce EMT and promote tumor progression in ccRCC through the EGFR/ERK signaling pathway. Overall, the results of this study suggest that the functions of ADAM12 in modulating EGFR/ERK signaling and EMT contribute greatly to its role in ccRCC progression.

Materials and methods

ccRCC cell culture and tissue specimens

Human ccRCC cell lines (769-P, 786-O, Caki-1, Caki-2, ACHN) and the human proximal tubular epithelial cell line HK-2 were acquired from the American Type Culture Collection (ATCC). They were cultured at 37 °C and 5% CO2 in recommended culture media that contained 10% fetal bovine serum and 100 U/mL penicillin/streptomycin. Tissue samples were collected from patients diagnosed at the Department of Urology, Peking University Shenzhen Hospital, China. In total, 30 pairs of ccRCC tissues and adjacent normal kidney tissues were collected from ccRCC patients confirmed by pathology and before receiving any treatment. All experiments obtained ethical approval from the hospital’s Ethics Committee, and patients were informed of their specimen content, potential risks, and purposes of the study and signed written informed consent.

Immunohistochemistry staining

Single spot tissue microarray (TMA) slides (150 cases of ccRCC, 30 cases of adjacent normal kidney tissues, HKidE180Su02, Shanghai Outdo Biotech Company, Shanghai, China) were prepared. The ADAM12 rabbit antibody (Proteintech, 1:3000) and the rabbit streptavidin–biotin detection system (Beijing Zhongshan Golden Bridge Biotechnology, Peking, China) were used for staining. According to the staining intensity (0 (negative), 0.5 + , 1 + , 2 + , and 3 +) and the staining positive rate (0–100%), two experienced pathologists evaluated the results. Then, the total score (0–300%) was calculated as the product of the staining intensity score and positive staining rate score. The low expression group had a score less than or equal to the median score, whereas the high expression group represented the opposite.

RNA isolation and RTq-PCR

TRIzol reagent (Takara, Japan) was used to extract the total RNA from specimens. Then, for each sample, 1 µg of total RNA was reverse transcribed by the PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, Japan) and amplified by qPCR in a LightCycler 480 (Roche, USA) with the SYBR Premix Ex Taq™ II Kit (Takara, Japan). GAPDH was selected as the internal reference gene, and the relative expression was calculated by the 2−ΔΔCt method. Primer sequences were synthesized by Sangon Biotech Company (Shanghai, China) and are listed below:

ADAM12-F: CGAGGGGTGAGCTTATGGAAC;

ADAM12-R: GCTTTCCCGTTGTAGTCGAATA;

GAPDH-F: CCACTCCTCCACCTTTGACG;

GAPDH-R: CTGGTGGTCCAGGGGTCTTA.

Western blot

Protein extraction and western blot assays were conducted as previously described [15]. The primary antibodies used in this study were anti-ADAM12 (Proteintech, 1:1000), anti-E-cadherin, anti-N-cadherin, anti-Vimentin, anti-Snail, anti-ERK1/2, anti-phosphorylated-ERK1/2 (all from Cell Signaling Technology, 1:1000), anti-GAPDH (Abclonal, 1:7000), anti-c-Myc (Abcam, 1:1000), anti-EGFR (Abcam, 1:5000), and anti-phosphorylated-EGFR (Abcam, 1:3000). The secondary antibody used here was HRP-linked anti-IgG (Cell Signaling Technology, 1:2000).

Viral infection

The human ADAM12 gene was amplified by PCR and cloned into a pHBLV-puro lentivirus vector. The ADAM12-targeting short hairpin RNA (shRNA) sequences were also cloned into pHBLV-puro, generated by HanBio (Shanghai, China). The shRNA sequences were CCACTATCTGCAAGACGGTACTGAT and ACCCATTCACCAGCCTCCATGAATT.

To establish a stable ccRCC cell line that could regulate the expression of ADAM12, 3 × 104 cells per well were seeded in a 6-well plate and infected with the lentiviruses. After 48–72 h, the expression efficiency of GFP was preliminarily observed by fluorescence microscopy, and stable infections were selected with puromycin at 4 μg/ml twice.

Drug treatment

Gefitinib (50 nM; Selleck, USA), an EGFR inhibitor, was dissolved in dimethyl sulfoxide (DMSO; Sigma‒Aldrich, Germany) and added to the corresponding medium. Meanwhile, the EGFR activator NSC228155 (100 μM, Selleck, USA) was dissolved in DMSO and used for subsequent rescue experiments. DMSO at 0.02% concentration was used as a control. Cells were harvested for 24 h, and then the corresponding inhibitor or activator was added for further western blot and functional assays.

CCK8 assay

ccRCC cells were inoculated into 96-well plates at a concentration of 3 × 103/ well with 100 µl culture medium. The plates were wrapped in tin foil and incubated for 5–6 h until the cells adhered to the wall. At 0 h, 24 h, 48 h and 72 h after transfection, 10 µl/well CCK-8 reagent was added under dark conditions. After 3 h of incubation, the culture plate was placed into a microplate reader, and the absorbance value (O.D. value) of each well was detected at 450 nm and then recorded.

Colony formation assay

Five hundred cells were cultured in 6-well plates for 2 weeks. Then, the cells were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet solution for 30 min. After that, images of the colonies were taken after two washes with PBS. Finally, the crystal violet was eluted completely with 33.3% glacial acetic acid and transferred to 96-well plates. The absorbance of each well was detected with a microplate plate at 590 nm.

Wound healing assay

Cells stably infected with lentivirus were cultured in 6-well plates. A linear scratch wound was created via a 10 µl pipette tip, and cell debris was removed by washing with PBS. Subsequently, the cells were supplemented with 2 ml of serum-free medium. The wound width was recorded by an inverted microscope every 24 h intervals, and the images were evaluated using ImageJ.

Transwell assay

Cell invasion was examined by Transwell assay, where 200 µl serum-free medium containing 3 × 104 cells was added to the upper chamber of Transwell (8 µm pore size, BD Biosciences, USA) coated with 50 µl Matrigel (BD Biosciences, USA). The lower chamber contained 500 µl of medium supplemented with 10% FBS. After 24 h of incubation at 37 °C, noninvaded cells were removed. Invaded cells were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and examined under a microscope. After eluting crystal violet with 33.3% glacial acetic acid, the liquid was transferred to 96-well plates, where the absorbance value was examined by a microplate reader.

RNA extraction and transcriptome sequencing

Total RNA was extracted as previously described [16]. After the assessment of RNA integrity, quality and quantity, the samples were transferred to Sangon Biotechnology (Shanghai) Co., Ltd. for library preparation and sequencing.

Bioinformatics analysis

The limma package in R software (R version 4.0) was applied to compare gene expression profiles between shNC and shADAM12 cell samples, Vector and OE-ADAM12 cell samples. The cut‐off criteria for identifying differentially expressed genes (DEGs) were |log2-fold‐change (FC)|> 2 and adjusted P < 0.05. A Venn diagram was constructed to obtain the overlapping DEGs by FunRich (http://www.funrich.org) [17]. The RobustRankAggreg (RRA) R package was used to plot the distribution of DEGs on the heatmap [18]. DEG identification via Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses was conducted on the DAVID database (version 6.8, http://david.ncifcrf.gov), and their potential functional relevance was explored. Biological processes (BP), molecular functions (MF), and cell components (CC) were assessed by GO enrichment analysis, while pathways were enriched by KEGG pathway analysis. An adjusted P < 0.05 was regarded as statistically significant.

In vivo xenograft model

The animal experiment protocol was approved by the Animal Ethics Committee of Shenzhen PKU-HKUST Medical Center. Twenty-four BALB/c nude mice (4–6 weeks) were split into 4 groups: shNC, shADAM12, Vector and OE-ADAM12. Transfected ACHN cells were resuspended in cold PBS buffer mixed with an equal volume of Matrigel. A mixture containing 3.5 × 106 cells was subcutaneously injected into the axilla of each mouse. The tumor volume was measured and calculated in 3-day intervals by the following formula: tumor volume = (length × width2)/2. All mice were sacrificed one month after injection. The subcutaneous tumor specimens of the four groups were collected, weighed and photographed, and further immunohistochemistry staining experiments were performed.

Statistics

GraphPad Prism 9 was utilized for statistical analysis, and data were presented as mean ± standard deviation (SD) with at least 3 repeats. Independent Student’s t test and one-way ANOVA were used for intergroup comparisons. Pearson’s chi-squared test or Fisher’s exact test was used to compare clinicopathological characteristics. Kaplan‒Meier survival analysis was performed for patient prognosis. P < 0.05 was considered statistically significant.

Results

ADAM12 was upregulated in ccRCC and correlated with poor prognosis

To investigate the potential role of ADAM12 in ccRCC, we compared the expression profiles of ADAM12 between ccRCC tissues and adjacent normal kidney tissues with The Cancer Genome Atlas (TCGA) database and Gene Expression Omnibus (GEO) database. TCGA database revealed that ADAM12 was significantly upregulated in ccRCC tissues and was positively correlated with T stage and tumor stage in ccRCC patients (p < 0.001) (Fig. 1A–C). And its high expression indicated a poor prognosis for ccRCC patients (Fig. 1D). By analyzing the clinicopathological characteristics and clinical outcomes, we discovered that the dysregulation of ADAM12 in ccRCC was associated with age, gender, local invasion (T stage), lymph node involvement (N stage), and distant metastasis (M stage) (Table 1). Moreover, GSE53757 and GSE73731 data sets showed a significantly higher expression of ADAM12 in ccRCC tissues tightly associated with tumor stage and grade (p < 0.05) (Fig. 1E–G). Furthermore, we assessed ADAM12 expression in 30 pairs of ccRCC and adjacent normal kidney tissues and discovered that it was significantly upregulated in cancer tissues (Fig. 1H–I). These results were further confirmed by immunohistochemistry staining (p = 0.006) (Fig. 1J, Table 2). In addition, both the transcription and translation levels of ADAM12 detected in ccRCC cell lines suggested that ADAM12 had significantly higher expression in ccRCC cells than in the HK-2 cell line (Fig. 1K–L).

Fig. 1
figure 1

ADAM12 was upregulated in ccRCC tissues and cell lines. A The expression of ADAM12 in ccRCC tissues was significantly higher than that in adjacent normal kidney tissues according to TCGA. B, C ADAM12 expression was positively associated with T stage and tumor stage in ccRCC patients. D The expression of ADAM12 was negatively correlated with overall survival in ccRCC patients. E GSE53757 data set showed a significantly higher expression of ADAM12 in ccRCC tissues. F, G GSE73731 data set revealed that the expression of ADAM12 in ccRCC was associated with tumor stage and grade. H, I The relative expression of ADAM12 in 30 pairs of ccRCC tissues and adjacent normal kidney tissues. Statistical analysis revealed that ADAM12 was dramatically upregulated in 30 ccRCC tissues compared to normal tissues. J IHC assays showed ADAM12 protein expression in different tumor stages of ccRCC tissues and adjacent normal kidney tissues. Scale bar = 50 μm. K, L The expression of ADAM12 in ccRCC cell lines and HK-2 cells at both the transcriptional and translational levels. *P < 0.05, **P < 0.01, ***P < 0.001

Full size image
Table 1 Correlation between ADAM12 expression and clinicopathological characters of patients with clear cell renal cell carcinoma (TCGA)
Full size table
Table 2 Differential expression of ADAM12 in cancer and adjacent tissues
Full size table

ADAM12 promoted the proliferation of ccRCC cells in vitro

To explore the biological function of ADAM12 in ccRCC, ccRCC cell lines with stable ADAM12 knockdown or overexpression were established. The infection efficiencies were verified by RT‐qPCR and western blot experiments. Figure 2A, B confirmed the successful knockdown of ADAM12 in CAKI-2 and 786-O cells after infection with shADAM12 lentivirus at both the transcriptional and translational levels. In contrast, ADAM12 was markedly overexpressed in ACHN and 786-O cells when infected with OE-ADAM12 lentivirus (Fig. 2C, D). The CCK8 results revealed that downregulation of ADAM12 caused a remarkable inhibition in the viability of CAKI-2 and 786-O cells (Fig. 2E), whereas upregulation of ADAM12 had the opposite effect on proliferation (Fig. 2F). The colony formation assay suggested that its knockdown notably attenuated the colony formation capacity of CAKI-2 and 786-O cells. Conversely, its overexpression facilitated colony formation of ACHN and 786-O cells (Fig. 2G, H). These results confirmed that ADAM12 promoted the proliferation of ccRCC cells.

Fig. 2
figure 2

ADAM12 promoted the proliferation of ccRCC cells. A, B ADAM12 was significantly downregulated in CAKI-2 and 786-O cells at both the transcriptional and translational levels after infection with shADAM12 lentivirus. C, D ADAM12 was markedly overexpressed in ACHN and 786-O cells at both the transcriptional and translational levels after infection with OE-ADAM12 lentivirus. E–F CCK-8 assays showed the proliferation capacity of ccRCC cells infected with the indicated lentivirus. G, H Colony formation assay revealed the colony number of ccRCC cells infected with the indicated lentivirus

Full size image

ADAM12 facilitated migration and invasion and induced EMT in ccRCC cells

Wound healing assays and transwell assays were conducted to investigate the effects of ADAM12 on the motility and invasiveness of ccRCC cells. The wound healing assay showed that silencing ADAM12 markedly inhibited the migration of CAKI-2 and 786-O cells, whereas restoring ADAM12 rescued the migration ability of ACHN and 786-O cells (Fig. 3A, B). Moreover, the transwell assay revealed that the invasive capacity of ccRCC cells was inhibited or strengthened after depletion or restoration of ADAM12 in ccRCC cells, respectively (Fig. 3C, D). To further examine whether EMT could be mediated by ADAM12, the expression of EMT transcription factors and related markers were analyzed by western blotting. In CAKI-2 and 786-O cells, after silencing ADAM12, the expression of E-cadherin was remarkably elevated, and the expression of N-cadherin and Snail were significantly reduced, while Vimentin was unaffected (Fig. 3E). We then overexpressed ADAM12 to explore whether it could reverse these changes. The results revealed that E-cadherin expression was downregulated, while N-cadherin and Snail expression were notably upregulated, leaving Vimentin intact (Fig. 3F). These changes further validated our results in the ADAM12 knockdown experiments and illustrated the role of ADAM12 in EMT induction.

Fig. 3
figure 3

ADAM12 facilitated migration and invasion and induced EMT in ccRCC cells. A, B Wound healing assay showed the migration capacity of ccRCC cells infected with the indicated lentivirus. C, D Transwell assay revealed that the invasive capacity of ccRCC cells was obviously inhibited or strengthened after depletion or restoration of ADAM12 in ccRCC cells, respectively. E The effect of ADAM12 knockdown on EMT marker expression was assessed by western blotting. F The effect of ADAM12 overexpression on EMT marker expression in ACHN and CAKI-2 cells

Full size image

ADAM12 enhanced the EGFR/ERK signaling pathway in ccRCC

To reveal the mechanism by which ADAM12 mediated the progression and EMT in ccRCC, we performed transcriptome sequencing and bioinformatics analysis. Volcano plots were generated for all DEGs by comparing shNC with shADAM12 cell samples and Vector with OE-ADAM12 cell samples (Fig. 4A). Notably, Venn software revealed that 17 overlapping DEGs were screened out (Additional file 1: Fig. S1, Additional file 1: Table S1). Through the RRA R package, the distribution of 17 overlapping DEGs was plotted on the heatmap (Fig. 4B). Then, GO and KEGG pathway enrichment analyses were conducted to explore the potential functional relevance among DEGs. The GO results suggested that DEGs were mainly involved in biological adhesion, multicellular organismal process, behavior and developmental process in BP; membrane part, extracellular matrix and region, and synapse in CC; and receptor regulator activity and transporter activity in MF (Fig. 4C). In addition, KEGG pathway enrichment analysis indicated that the Ras signaling pathway might be involved in ccRCC cells after ADAM12 stimulation (Fig. 4D). Moreover, previous studies reported that ADAM12-mediated shedding of EGFR ligands resulted in inducing the phosphorylation of EGFR and activating subsequent downstream signaling, including the Ras-MEK-ERK/MAPK, PI3K/AKT and JAK/STAT pathways [19, 20]. To further determine whether the EGFR/ERK pathway could be activated by ADAM12 in ccRCC cells, we conducted western blotting. The results revealed that silencing ADAM12 suppressed the phosphorylation levels of EGFR and ERK1/2 and downregulated c-Myc expression. However, overexpression of ADAM12 markedly promoted c-Myc expression and the phosphorylation of EGFR and ERK1/2 (Fig. 4E, F). These changes validated the role of ADAM12 in the EGFR/ERK signaling pathway.

Fig. 4
figure 4

ADAM12 enhanced the EGFR/ERK signaling pathway in ccRCC. A Volcano plots of the distribution of DEGs by comparing shNC with shADAM12 cell samples and Vector with OE-ADAM12 cell samples. B The distribution of DEGs was plotted on the heatmap. C, D The biological functions of the integrated DEGs were explored by GO and KEGG enrichment analysis. E, F Western blot revealed the expression of EGFR/ERK and c-Myc proteins upon the knockdown and overexpression of ADAM12

Full size image

Silencing ADAM12 abolished the positive action of the EGFR activator on the proliferation, metastasis and EMT process of ccRCC cells

To examine whether its effect on EGFR/ERK signaling affected the progression and metastasis of ccRCC, we treated the cells with NSC228155, a specific EGFR agonist. The CCK8 assay revealed that the activation of EGFR dramatically elevated the viability of CAKI-2 and 786-O cells, and silencing ADAM12 counteracted this effect (Fig. 5A). Colony formation assays suggested that activating EGFR led to a remarkable increase in the colony number, while the knockdown of ADAM12 narrowed the change (Fig. 5B). Both wound healing and transwell assays indicated that the capacities of migration and invasion were improved after treatment with NSC228155. In addition, the depletion of ADAM12 reversed the promoting effect of NSC228155 on cell migration and invasion (Fig. 5C, D). Protein level analysis showed that the phosphorylation levels of EGFR and ERK1/2 rose significantly under NSC228155 treatment in CAKI-2 and 786-O cells. E-cadherin expression was markedly decreased, while c-Myc, N-cadherin and Snail expression were increased (Fig. 5E, F). However, this regulatory effect could be abolished by silencing ADAM12. Collectively, the EGFR phosphorylation activator reversed the inhibitory action of ADAM12 on proliferation, migration, invasion and EMT in ccRCC.

Fig. 5
figure 5

Silencing ADAM12 abolished the positive action of the EGFR activator on the proliferation, metastasis and EMT process of ccRCC cells. A CCK8 assay revealed the viability of CAKI-2 and 786-O cells treated with shADAM12 lentivirus and EGFR activator NSC228155. B Colony formation assays showed the colony number of CAKI-2 and 786-O cells treated with shADAM12 lentivirus and NSC228155. C The wound healing assay showed the migration capacity of CAKI-2 and 786-O cells treated with shADAM12 lentivirus and NSC228155. D Transwell assay indicated the invasion capacity of CAKI-2 and 786-O cells treated with shADAM12 lentivirus and NSC228155. E–F Western blot assay revealed the expression of the indicated proteins in CAKI-2 and 786-O cells treated with shADAM12 lentivirus and NSC228155

Full size image

EGFR blocking antagonized the effects of ADAM12 in ccRCC

To better clarify how ADAM12-induced proliferation, migration, invasion and EMT were regulated via the EGFR/ERK signaling pathway, ccRCC cells were treated with gefitinib, an EGFR phosphorylation inhibitor. Cell proliferation assays indicated that suppressing EGFR phosphorylation significantly reduced cell viability and cell growth in ACHN and 786-O cells. Overexpression of ADAM12 eliminated these inhibitory effects (Fig. 6A, B). Wound healing and transwell assays showed that gefitinib treatment dramatically decreased the number of migrated and invaded cells, while restoration of ADAM12 antagonized EGFR inhibition (Fig. 6C, D). In addition, western blot analysis showed that gefitinib significantly reduced the phosphorylation levels of EGFR and ERK1/2 and the expression levels of c-Myc, N-cadherin and Snail but increased E-cadherin expression (Fig. 6E, F). However, this inhibitory effect could be reversed by overexpression of ADAM12. These findings supported that the effects of ADAM12 on various ccRCC cell activities were achieved by phosphorylating EGFR.

Fig. 6
figure 6

EGFR blocking antagonized the effects of ADAM12 in ccRCC. A CCK-8 assay revealed the viability of ACHN and 786-O cells treated with OE-ADAM12 lentivirus and the EGFR inhibitor gefitinib. B Colony formation assays showed the colony number of ACHN and 786-O cells treated with OE-ADAM12 lentivirus and gefitinib. C The wound healing assay showed the migration capacity of ACHN and 786-O cells treated with OE-ADAM12 lentivirus and gefitinib. D Transwell assay indicated the invasion capacity of ACHN and 786-O cells treated with OE-ADAM12 lentivirus and gefitinib. E, F Western blot assay revealed the expression of the indicated proteins in ACHN and 786-O cells treated with OE-ADAM12 lentivirus and gefitinib

Full size image

ADAM12 promoted the growth of ccRCC cells in vivo

Finally, an in vivo model was established to gain more information on the role of ADAM12 in the growth of ccRCC. ACHN cells stably infected with shADAM12 or OE-ADAM12 were injected subcutaneously into the axilla of nude mice (n = 6 for each group). In the xenograft tumor model, ADAM12 knockdown significantly repressed the volume and weight of the tumors, whereas ADAM12 overexpression had the opposite effect (Fig. 7A, B). Moreover, the IHC assay demonstrated that the levels of ADAM12, c-Myc, N-cadherin and Snail drastically decreased after silencing ADAM12, whereas E-cadherin markedly increased, suggesting inhibition of tumor growth and the EMT process (Fig. 7C). The opposite effects occurred after overexpressing ADAM12 (Fig. 7D).

Fig. 7
figure 7

ADAM12 promoted the growth of ccRCC cells in vivo. A, B ACHN cells stably infected with shADAM12 or OE-ADAM12 were injected subcutaneously into the axilla of nude mice (n = 6 for each group) to create a xenograft tumor model. The tumor growth curves were documented according to the measurement of tumor volume every 3 days, and the tumor weight was measured. C, D Representative immunohistochemistry images of xenograft tumor tissues for HE, ADAM12, c-Myc, E-cadherin, N-cadherin and Snail staining

Full size image

Discussion

ADAM12, which belongs to the ADAM family, has unique characteristics, including extracellular metalloproteinase, cell-binding functions, and intracellular signal transduction capabilities [21]. It is worth noting that ADAM12, a secreted protein that can be detected in both blood and body fluids, is a good potential tumor biomarker. Previous evidence supported the oncogenic role of ADAM12 in multiple types of tumors. It promoted cell proliferation in glioblastoma through the stimulation of ectodomain shedding of proHB-EGF [22]. Moreover, ADAM12 significantly upregulated pro-angiogenic factors and increased endothelial cell recruitment in a STAT3-dependent manner to promote tumor angiogenesis in breast cancer [23]. Although Gao et al. predicted that ADAM12 might be a potential prognostic factor in ccRCC by bioinformatics analysis [14], both in vitro and in vivo experimental validations were lacking. This study could supplement this blank topic and elucidate the mechanism of ADAM12 in the development and progression of ccRCC.

In this study, we utilized the TCGA and GEO databases combined with our clinical specimens to evaluate the expression of ADAM12 in ccRCC and its correlation with clinicopathological factors and clinical outcomes. The data suggested that ADAM12 was highly expressed in most ccRCC tissues, mainly in the cytoplasm. Its expression was significantly correlated with gender, age, T stage, N stage and M stage. In addition, Kaplan‒Meier analysis showed that high expression of ADAM12 indicated poorer overall survival. Both our in vitro and in vivo assays demonstrated the oncogenic role of ADAM12 in ccRCC. We found that abnormally high ADAM12 expression promoted tumor growth and metastasis by enhancing cell proliferation, migration, and invasion. The positive effect of ADAM12 on tumor growth was further confirmed in a subcutaneous xenograft tumor mouse model. Nevertheless, ADAM12 knockdown significantly inhibited cell proliferation, clonogenicity, cell migration and invasion. Therefore, we hypothesized that ADAM12 might potentially be a therapeutic target for ccRCC treatment.

It was well-known that EMT mediated the response to various signaling factors, including embryonic development, fibrosis, wound healing, cancer metastasis, and proliferation [24]. EMT was typically activated in malignant tumors and acted as the initiation of tumor invasion and metastasis, triggering the separation of cancer cells from primary cancer and subsequently spreading to distant sites [25]. In this study, we observed that overexpression of ADAM12 induced the specific EMT transcription factor Snail. This could later reduce the expression of the epithelial marker E-cadherin and enhance the expression of the mesenchymal marker N-cadherin. Nevertheless, silencing ADAM12 had the opposite effects on EMT. These changes in all biomarkers indicated that ADAM12-mediated invasion and metastasis of ccRCC were correlated with the induction of EMT.

Previous studies reported that ADAM12 might mediate the release of soluble EGFR ligands, thereby activating EGFR [26, 27]. Notably, the phosphorylation of EGFR activated diverse intracellular processes, such as accelerating cell proliferation and invasion, suppressing apoptosis and stimulating tumor angiogenesis [28]. Moreover, EGFR was an upstream regulator of the Ras signaling pathway [29], and its activation was a major trigger for the progression of most carcinomas [30]. Since EMT could be modulated by multiple signaling pathways, including PTEN/Akt [31], Wnt/β-Catenin [32], PI3K/Akt [33], and MAPK [34], we first speculated whether ADAM12 induced EMT progression through the EGFR/RAS signaling pathway in ccRCC.

To validate these predictions, we conducted biological experiments. We found that ADAM12 overexpression markedly promoted EGFR and ERK1/2 phosphorylation and increased c-Myc expression. As an important target downstream of the ERK/MAPK pathway, a high level of c-Myc expression was tightly associated with cell proliferation and the induction of EMT in various carcinomas [35,36,37,38]. Cho et al. demonstrated that overexpression of c-Myc inactivated ERK-dependent GSK-3β and activated Snail, which could induce EMT in mammary epithelial cells [37]. In our study, we inhibited EGFR with gefitinib and discovered decreased phosphorylation levels of EGFR and ERK1/2. The transcription factors c-Myc and Snail and the mesenchymal marker N-cadherin were downregulated, whereas the epithelial marker E-cadherin was upregulated. These results suggested that inhibiting the EGFR/ERK pathway affected cell proliferation and EMT. However, overexpression of ADAM12 partially eliminated the effects, which was consistent with the evidence that ADAM12 was an upstream regulator of the EGFR/ERK pathway. These results proved that the oncogenic function of ADAM12 in cell proliferation and EMT was dependent on the activation of EGFR/ERK pathway. However, its two distinct isoforms in the regulation of EGFR/ERK signaling pathway in human cancers were unknown. The specific isoform of ADAM12 may provide greater help for the precisely targeted therapy of ccRCC in the future.

Conclusion

Taking together, ADAM12 acts to facilitate the EGFR/ERK signaling pathway and enhance the function to activate c-Myc and EMT-related molecules such as E-cadherin, N-cadherin and Snail, leading to the induction of EMT and the promotion of ccRCC growth and metastasis. However, it remains unclear whether ADAM12-L or ADAM12-S plays a more vital role in ccRCC progression. All of the above will be further investigated in our future study.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Abbreviations

RCC:

Renal cell carcinoma

ccRCC:

Clear cell renal cell carcinoma

EGFR:

Epidermal growth factor receptor

EMT:

Epithelial-mesenchymal transition

IHC:

Immunohistochemistry staining

RT‒qPCR:

Reverse transcription-quantitative PCR

DEG:

Differentially expressed gene

TCGA:

The cancer genome atlas

GEO:

Gene expression omnibus

RRA:

Robust rank aggregation

GO:

Gene ontology

KEGG:

Kyoto encyclopedia of genes and genomes

References

  1. Vig SVL, Zan E, Kang SK. Imaging for metastatic renal cell carcinoma. Urol Clin North Am. 2020;47:281–91.

    Article  Google Scholar 

  2. Pontes O, Oliveira-Pinto S, Baltazar F, Costa M. Renal cell carcinoma therapy: current and new drug candidates. Drug Discov Today. 2022;27:304–14.

    Article  CAS  Google Scholar 

  3. Linehan WM, Ricketts CJ. The cancer genome atlas of renal cell carcinoma: findings and clinical implications. Nat Rev Urol. 2019;16:539–52.

    Article  CAS  Google Scholar 

  4. Cohen HT, McGovern FJ. Renal-cell carcinoma. N Engl J Med. 2005;353:2477–90.

    Article  CAS  Google Scholar 

  5. Duffy MJ, McKiernan E, O’Donovan N, McGowan PM. The role of ADAMs in disease pathophysiology. Clin Chim Acta. 2009;403:31–6.

    Article  CAS  Google Scholar 

  6. Duhachek-Muggy S, Qi Y, Wise R, Alyahya L, Li H, Hodge J, et al. Metalloprotease-disintegrin ADAM12 actively promotes the stem cell-like phenotype in claudin-low breast cancer. Mol Cancer. 2017;16:32.

    Article  Google Scholar 

  7. Gilpin BJ, Loechel F, Mattei MG, Engvall E, Albrechtsen R, Wewer UM. A novel, secreted form of human ADAM 12 (meltrin alpha) provokes myogenesis in vivo. J Biol Chem. 1998;273:157–66.

    Article  CAS  Google Scholar 

  8. Li H, Duhachek-Muggy S, Qi Y, Hong Y, Behbod F, Zolkiewska A. An essential role of metalloprotease-disintegrin ADAM12 in triple-negative breast cancer. Breast Cancer Res Treat. 2012;135:759–69.

    Article  CAS  Google Scholar 

  9. Wang J, Zhang Z, Li R, Sun W, Chen J, Zhang H, et al. Triptolide inhibits pituitary adenoma cell viability, migration and invasion via ADAM12/EGFR signaling pathway. Life Sci. 2018;194:150–6.

    Article  CAS  Google Scholar 

  10. Fröhlich C, Albrechtsen R, Dyrskjøt L, Rudkjaer L, Ørntoft TF, Wewer UM. Molecular profiling of ADAM12 in human bladder cancer. Clin Cancer Res. 2006;12:7359–68.

    Article  Google Scholar 

  11. Park YL, Park SY, Oh HH, Chung MW, Hong JY, Kim KH, et al. A disintegrin and metalloprotease 12 promotes tumor progression by inhibiting apoptosis in human colorectal cancer. Cancers (Basel). 2021. https://doi.org/10.3390/cancers13081927.

    Article  Google Scholar 

  12. Zhu H, Jiang W, Zhu H, Hu J, Tang B, Zhou Z, et al. Elevation of ADAM12 facilitates tumor progression by enhancing metastasis and immune infiltration in gastric cancer. Int J Oncol. 2022. https://doi.org/10.3892/ijo.2022.5341.

    Article  Google Scholar 

  13. Duan Q, Li D, Xiong L, Chang Z, Xu G. SILAC quantitative proteomics and biochemical analyses reveal a novel molecular mechanism by which ADAM12S promotes the proliferation, migration, and invasion of small cell lung cancer cells through upregulating hexokinase 1. J Proteome Res. 2019;18:2903–14.

    Article  CAS  Google Scholar 

  14. Gao J, Yang D, Xu H, Yang K, Ma J, Xia J, et al. ADAM metallopeptidase domain 12 overexpression correlates with prognosis and immune cell infiltration in clear cell renal cell carcinoma. Bioengineered. 2022;13:2412–29.

    Article  CAS  Google Scholar 

  15. Wei Z, Xu J, Li W, Ou L, Zhou Y, Wang Y, et al. SMARCC1 enters the nucleus via KPNA2 and plays an oncogenic role in bladder cancer. Front Mol Biosci. 2022;9:902220.

    Article  CAS  Google Scholar 

  16. Zhou Y, Ou L, Xu J, Yuan H, Luo J, Shi B, et al. FAM64A is an androgen receptor-regulated feedback tumor promoter in prostate cancer. Cell Death Dis. 2021;12:668.

    Article  CAS  Google Scholar 

  17. Pathan M, Keerthikumar S, Ang CS, Gangoda L, Quek CY, Williamson NA, et al. FunRich: an open access standalone functional enrichment and interaction network analysis tool. Proteomics. 2015;15:2597–601.

    Article  CAS  Google Scholar 

  18. Kolde R, Laur S, Adler P, Vilo J. Robust rank aggregation for gene list integration and meta-analysis. Bioinformatics. 2012;28:573–80.

    Article  CAS  Google Scholar 

  19. Huang L, Fu L. Mechanisms of resistance to EGFR tyrosine kinase inhibitors. Acta Pharm Sin B. 2015;5:390–401.

    Article  Google Scholar 

  20. Zahnow CA. ErbB receptors and their ligands in the breast. Expert Rev Mol Med. 2006;8:1–21.

    Article  Google Scholar 

  21. Kveiborg M, Albrechtsen R, Couchman JR, Wewer UM. Cellular roles of ADAM12 in health and disease. Int J Biochem Cell Biol. 2008;40:1685–702.

    Article  CAS  Google Scholar 

  22. Kodama T, Ikeda E, Okada A, Ohtsuka T, Shimoda M, Shiomi T, et al. ADAM12 is selectively overexpressed in human glioblastomas and is associated with glioblastoma cell proliferation and shedding of heparin-binding epidermal growth factor. Am J Pathol. 2004;165:1743–53.

    Article  CAS  Google Scholar 

  23. Roy R, Dagher A, Butterfield C, Moses MA. ADAM12 is a novel regulator of tumor angiogenesis via STAT3 signaling. Mol Cancer Res. 2017;15:1608–22.

    Article  CAS  Google Scholar 

  24. Nieto MA, Huang RY, Jackson RA, Thiery JPEMT. Cell. 2016;2016(166):21–45.

    Article  Google Scholar 

  25. Thiery JP, Acloque H, Huang RY, Nieto MA. Epithelial-mesenchymal transitions in development and disease. Cell. 2009;139:871–90.

    Article  CAS  Google Scholar 

  26. Kataoka H. EGFR ligands and their signaling scissors, ADAMs, as new molecular targets for anticancer treatments. J Dermatol Sci. 2009;56:148–53.

    Article  CAS  Google Scholar 

  27. Blobel CP. ADAMs: key components in EGFR signalling and development. Nat Rev Mol Cell Biol. 2005;6:32–43.

    Article  CAS  Google Scholar 

  28. Ciardiello F, Tortora G. EGFR antagonists in cancer treatment. N Engl J Med. 2008;358:1160–74.

    Article  CAS  Google Scholar 

  29. Leonetti A, Sharma S, Minari R, Perego P, Giovannetti E, Tiseo M. Resistance mechanisms to osimertinib in EGFR-mutated non-small cell lung cancer. Br J Cancer. 2019;121:725–37.

    Article  Google Scholar 

  30. Guo YJ, Pan WW, Liu SB, Shen ZF, Xu Y, Hu LL. ERK/MAPK signalling pathway and tumorigenesis. Exp Ther Med. 2020;19:1997–2007.

    Google Scholar 

  31. Xu J, Liu D, Niu H, Zhu G, Xu Y, Ye D, et al. Resveratrol reverses doxorubicin resistance by inhibiting epithelial-mesenchymal transition (EMT) through modulating PTEN/Akt signaling pathway in gastric cancer. J Exp Clin Cancer Res. 2017;36:19.

    Article  Google Scholar 

  32. Wang J, Cai H, Liu Q, Xia Y, Xing L, Zuo Q, et al. Cinobufacini inhibits colon cancer invasion and metastasis via suppressing Wnt/β-catenin signaling pathway and EMT. Am J Chin Med. 2020;48:703–18.

    Article  CAS  Google Scholar 

  33. Xu W, Yang Z, Lu N. A new role for the PI3K/Akt signaling pathway in the epithelial-mesenchymal transition. Cell Adh Migr. 2015;9:317–24.

    Article  CAS  Google Scholar 

  34. Sheng W, Shi X, Lin Y, Tang J, Jia C, Cao R, et al. Musashi2 promotes EGF-induced EMT in pancreatic cancer via ZEB1-ERK/MAPK signaling. J Exp Clin Cancer Res. 2020;39:16.

    Article  CAS  Google Scholar 

  35. Xie L, Law BK, Chytil AM, Brown KA, Aakre ME, Moses HL. Activation of the Erk pathway is required for TGF-beta1-induced EMT in vitro. Neoplasia. 2004;6:603–10.

    Article  CAS  Google Scholar 

  36. Navandar M, Garding A, Sahu SK, Pataskar A, Schick S, Tiwari VK. ERK signalling modulates epigenome to drive epithelial to mesenchymal transition. Oncotarget. 2017;8:29269–81.

    Article  Google Scholar 

  37. Cho KB, Cho MK, Lee WY, Kang KW. Overexpression of c-myc induces epithelial mesenchymal transition in mammary epithelial cells. Cancer Lett. 2010;293:230–9.

    Article  CAS  Google Scholar 

  38. Amatangelo MD, Goodyear S, Varma D, Stearns ME. c-Myc expression and MEK1-induced Erk2 nuclear localization are required for TGF-beta induced epithelial-mesenchymal transition and invasion in prostate cancer. Carcinogenesis. 2012;33:1965–75.

    Article  CAS  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This study was supported by the grant from the Sanming Project of Medicine in Shenzhen (No. SZSM202111007), the Science Technology and Innovation Commission of Shenzhen Municipality (No. JCYJ20220530150812027, No. JCYJ20190809104411245 and No. JCYJ20180228175430794), the Medical Scientific Research Foundation of Guangdong Province (A2021126), and the Shenzhen High-level Hospital Construction Fund.

Author information

Author notes

  1. Jinming Xu and Yan Wang have contributed equally to this work

Authors and Affiliations

  1. Department of Urology, Shenzhen Second People’s Hospital/First Affiliated Hospital of Shenzhen University, Shenzhen, 518035, Guangdong, China

    Jinming Xu, Jiahao Jiang, Cong Yin & Bentao Shi

  2. Shantou University Medical College, Shantou, 515041, Guangdong, China

    Jinming Xu

  3. Department of Urology, Peking University Shenzhen Hospital, Shenzhen, 518036, Guangdong, China

    Yan Wang

Authors
  1. Jinming Xu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yan Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Jiahao Jiang
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Cong Yin
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Bentao Shi
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

JX, JJ and CY performed the experiments and data analysis. JX and YW prepared diagrams and wrote the manuscript. JX, YW and BS designed the project and supervised the project. YW and BS provided financial support. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Bentao Shi.

Ethics declarations

Ethics approval and consent to participate

Patients were diagnosed at the Department of Urology, Peking University Shenzhen Hospital, China. All experiments strictly followed the “Helsinki Declaration” and obtained ethical approval from the Ethics Committee of Peking University Shenzhen Hospital. All patients were informed of their specimen content, potential risks, and purposes of the study and signed written informed consent. All animal protocols were in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Peking University Shenzhen Hospital Animal Care and Use Committee.

Consent for publication

Not applicable.

Competing interests

The authors declared that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1.

Table S1. The relative expression of 17 overlapping DEGs via comparison between Vector and OE-ADAM12 group. Figure S1. Venn diagram representing the number of overlapping DEGs.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Xu, J., Wang, Y., Jiang, J. et al. ADAM12 promotes clear cell renal cell carcinoma progression and triggers EMT via EGFR/ERK signaling pathway. J Transl Med 21, 56 (2023). https://doi.org/10.1186/s12967-023-03913-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12967-023-03913-1

Keywords

Journal of Translational Medicine

ISSN: 1479-5876

Contact us