Human tissue samples
Tumor tissue samples were collected from 71 treatment-naïve EC patients who underwent surgery at the Third Affiliated Hospital of Guangzhou Medical University. The samples were snap frozen in liquid nitrogen immediately after resection and stored at − 80 °C. The study protocol was approved by the ethics committee of the hospital, and all patients provided written informed consent.
Cell culture and transfection
Human EC cell lines (Ishikawa, HEC1A, HEC1B, and KLE) and immortalized endometrial cells (EEC) were purchased from ATCC (Manassas, VA, USA) or Jennio Biotech (Guangzhou, China). HEC1B cells were cultured in DMEM (HyClone, Logan, UT, USA), HEC1A and Ishikawa cells in RPMI-1640 medium (HyClone), and the KLE cells in DMEM-F12 (HyClone). All media were supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) and 100 U/ml penicillin and streptomycin (Gibco). The cell lines were incubated at 37 °C under 5% CO2. As per the experimental requirements, the cells were transfected with SNORD104 ASO (TCTTTCTCGTAAATGCTGAG), si-FBL (GGGCTAAGGTTCTCTACCT), or si-PARP1 (CACGGACTCTCTACCGTAT) using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The oligonucleotides were synthesized by RIBOBIO (Guangzhou, China).
Bioinformatics analysis
The clinical and transcriptomic data of EC were downloaded from https://portal.gdc.cancer.gov/projects/TCGA-UCEC, ITPR3, LMNB1, PARP1, PARP4, and TUBA1C protein expression in EC tissues was analyzed using the CPTAC [10] database (http://ualcan.path.uab.edu). The correlation between PARP1 expression and prognosis of EC patients was evaluated by Kaplan–Meier survival analysis using KMplot [11] (http://kmplot.com).
Cell viability assays
The cells were seeded in a 96-well plate at the density of 2000 cells/100 μl per well and transfected with the respective constructs. The CCK8 reagent (Yeasen Biotechnology, Shanghai, China) was added to the cells at 0, 24, 48, and 72 h, and the absorbance of each well was measured at 450 nm using a microplate reader (BioTek, Winooski, VT, USA). The experiment was repeated thrice.
Colony formation assay
The cells were seeded in a 6-well plate at the density of 500 cells/2 ml per well and transfected with the respective constructs once they adhered. After culturing for 7–10 days, the colonies were fixed using formaldehyde for 15 min, washed thrice with PBS, and stained with crystal violet for 10 min. The plates were rinsed with tap water to remove the excess dye and dried, and the number of colonies was counted.
EdU assay
The Ishikawa/HEC1B cells were seeded in 96-well plates, and EdU solution (Thermo Scientific, USA) was added. The cells were incubated for 16 h, and the subsequent steps were followed as per the manufacturer's instructions. The stained cells were observed under a microscope (Olympus, Tokyo, Japan).
Apoptosis assay
Apoptosis was detected by propidium iodide (PI) and fluorescein isothiocyanate (FITC)-Annexin V (BD Pharmingen, San Diego, CA, USA) staining according to the manufacturer's instructions. Briefly, the cells were harvested 48 h after transfection and washed twice with cold PBS. The suspension was stained with 100 μl 1 × buffer and 5 μl FITC-Annexin V and PI in the dark for 15 min. The reaction was terminated by adding 400 μl 1 × buffer, and the cells were analyzed by flow cytometry within 1 h.
Quantitative real‐time reverse transcription PCR
Total RNA was extracted from EC cell lines or tissues using TRIzol reagent (1 ml; Takara, Shiga, Japan) and reverse transcribed to cDNA. Quantitative real-time PCR was performed using the SYBR PreMix Ex TAQ II kit (Takara). The primer sequences were as follows: U6: forward: 5ʹ CTCGCTTCGGCAGCACA 3ʹ; reverse: 5ʹ AACGCTTCACGAATTTGCGT 3ʹ; GAPDH: forward: 5ʹ CCCATCACCATCTTCCAGGAG 3ʹ; reverse: 5ʹ GTTGTCATGGATGACCTTGGC 3ʹ; SNORD104: forward: 5ʹ CATTCCAATTAAAGCACG 3ʹ; reverse: 5ʹ CAGACTCCAGTTCGCATC 3ʹ; PARP1: forward: 5ʹ CGGAACAAGGATGAAGTGAA 3ʹ; reverse: 5ʹ TTGGTGGAGGCGGAGA 3ʹ; PARP4: forward: 5ʹ TAGCCTGGTCATTTGGT 3ʹ; reverse: 5ʹ AGATGGCATTCTTCACG 3ʹ; 18S: forward: 5ʹ GAAACGGCTACCACATCC 3ʹ; reverse: 5ʹ ACCAGACTTGCCCTCCA 3ʹ; ITPR3: forward: 5ʹ CCAAGCAGACTAAGCAGGACA 3ʹ; reverse: 5ʹ ACACTGCCATACTTCACGACA 3ʹ; LMNB1: forward: 5ʹ AAGCATGAAACGCGCTTGG 3ʹ; reverse: 5ʹ AGTTTGGCATGGTAAGTCTGC 3ʹ; TUBA1C: forward: 5ʹ TGTTTGTAGACTTGGAACCCAC 3ʹ; reverse: 5ʹ GCCAATGGTGTAGTGCCCT 3ʹ.
Western blotting
Total protein was extracted from cultured cells or tissues using radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitors and quantified using the BCA Protein Assay Kit (Beyotime, China). The protein samples were diluted with the appropriate amount of loading buffer and PBS to 2 μg/l, and denatured by heating at 95 °C for 15 min. The samples were resolved by 10% or 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes (Amersham, Munich, Germany). Following overnight incubation with rabbit anti-FBL (1:2000 Magna, Proteintech, Rosemont, IL, USA), rabbit anti-PARP1 (1:2000 Magneto, Proteintech), rabbit anti-PARP4 (1:2000, Bioss, Woburn, MA, USA), anti-ITPR3 (1:2000, LSBio), anti-LMNB1 (1:10,000, Proteintech), anti-Vinculin (1:10,000, Proteintech), anti-GAPDH (1:5000, Proteintech) and anti-α-tubulin (TUBA1B/1C) (1:2000, Proteintech) antibodies at 4 ℃, the membranes were washed thrice with 1% Tris-buffered saline-Tween20 (TBST) buffer for 10 min each time. The membranes were then incubated with the secondary antibody for 2 h, and washed again with 1% TBST buffer for 10 min. The bands were visualized using an enhanced chemiluminescence system (NCM Biotech, Suzhou, China), and the protein levels were quantified using grayscale values.
RNA immunoprecipitation (RIP) assay
RIP assay was performed using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA) as per the manufacturer's instructions. Cells growing at 80–90% confluence were harvested and lysed using RIPA lysis buffer. The cell extracts were incubated with magnetic beads with anti-mouse FBL (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or normal mouse IgG (negative control) in the RIPA lysis buffer. After digesting the protein using protease K, the immunoprecipitated RNA was isolated and analyzed using qRT-PCR.
Nm-seq analysis
Nm-sequencing was performed by the Shanghai Cloud-seq Biotech Co. Ltd. as previously described [12] using the Illumina NovaSeq 6000 sequencer.
Reverse transcription at low dNTPs-PCR (RTL-P) assay
RTL-P assay was performed to detect the 2′-O-methylation level (Nm) of PARP1 according to published methods [13, 14]. Briefly, 5 μg total RNA was incubated with low (1 μM) or high (1 mM) concentration of dNTPs (Takara) and 1 μl specific RT primers at 65 °C for 5 min and then placed on ice. The reaction was performed using 4 μl M-MLV RT 5 × buffer (PROMEGA), 1 μl 200 U/μl M-MLV Reverse Transcriptase (PROMEGA), 1 μl 0.1 M DTT (PROMEGA), and 1 μl 40 U/μl RNase inhibitor (PROMEGA) at 50 °C for 1 h, and then at 70 °C for 15 min. QRT-PCR was performed on the SYBR Prime X Ex-TAQ Patent II Suite (Takara) using PARP1-specific primers. The relative expression of the gene was calculated by comparing the period threshold (Ct) of the target gene in the experimental group and the control group at low concentrations according to the 2−ΔCt method.
RNA stability assay
Stably transfected cells were seeded into a 6-well plate and incubated until they reached 70% confluence. Actinomycin D (Sigma, St. Louis, MO, USA) was added (Act D, 5 µg/ml), and the cells were harvested at 0, 6, and 12 h. Total RNA was extracted using TRIzol reagent, and PARP1 mRNA levels were detected by qRT-PCR.
Nucleocytoplasmic separation assay
The confluent cells were harvested using a scraper and centrifuged at 1500 rpm for 5 min. The supernatant was removed, and the nuclear and cytoplasmic fractions were extracted from the cells using a specific kit (Beyotime, Shanghai, China). Both fractions were analyzed by western blotting as per standard protocols.
Nude mouse xenograft assay
All animal experiments were conducted in accordance with the guidelines of the National Institute of Health on the Care and Use of Experimental Animals and were approved by the Animal Care and Use Committee of Guangzhou Medical University. Four-week-old female BALB/c nude mice were purchased from Guangdong Experimental Animal Center (Foshan, China) and housed under controlled temperature and light (12 h dark/12 h light) with ad libitum access to food and water. The mice were injected subcutaneously into their right flanks with 1 × 107 tumor cells suspended in 200 μl of FBS-supplemented culture medium. The tumors were measured twice a week, and the volume was calculated according to the formula (length × width2)/2. At the end of the experiment (or when the mice died), the mice were euthanized, and the tumors were excised.
Statistical analysis
GraphPad Prism [version 8.02(263)] was used for statistical analysis. Non-parametric Mann–Whitney test for small samples that do not meet the normal distribution; Student's t-test was used for the normal distribution and when the sample size was large; Correlations between groups were determined using the Pearson correlation coefficient. The CCK-8 assay data were analyzed using ANOVA. All data were presented as the mean ± S.D of at least three independent experiments. Statistical significance was set at P < 0.05.