Skip to main content


We're creating a new version of this page. See preview

  • Research
  • Open Access

Influence of gene modification in biological behaviors and responses of mouse lung telocytes to inflammation

Contributed equally
Journal of Translational Medicine201917:158

  • Received: 1 March 2019
  • Accepted: 3 April 2019
  • Published:



Telocytes play key roles in maintenance of organ/tissue function and prevention of organ injury. However, there are great challenges to investigate telocytes functions using primary telocytes, due to the difficulties of isolation, identification, and stability. The present study aims at constructing continuous cell strain of mouse lung telocyte cell line with stable characters by gene modification and investigating biological behaviors and responses of gene-modified telocytes to inflammation.


Mouse primary lung telocytes were isolated and identified using immune-labeling markers and immunoelectron microscopy. Primary telocytes were transformed with Simian vacuolating virus 40 small and large T antigen (SV40). Biological characters, behaviors morphology, and proliferation of those gene-modified telocytes were defined and monitored dynamically for 50 generations, as compared with primary lung telocytes. Cell cycle of mouse primary lung telocytes or gene-modified telocytes was detected by flow cytometry.


Gene modified telocytes of generations 5, 10, 30 and 50 were observed with telopodes and also showed CD34 and ckit positive. Multiple cellular morphology were also observed on telocyte cell-line under monitor of celliq and enhanced cell proliferation were showed. SV40 transduction was also reduced apoptosis and increased the ratio of S and G2 phases in telocyte cell-line.


We successfully constructed mouse lung telocyte cell-line which maintained the biological properties and behaviors as primary telocytes and could responses to inflammation induced by LPS. Thus, gene-modified lung telocytes, Telocyte Line, would provide a cell tool for researchers exploring the roles and applications of telocytes involved in physiological and pathological states in future.


  • Telocytes
  • Gene modification
  • Lung
  • SV40
  • Transformation


Telocytes (TCs) have been found widely spreaded in a large number of organs and tissues of mammals, including atrial and ventricular myocardium, bladder, lung skeletal muscle, gastrointestinal tract, eyes, and others. TCs communicate with neighboring cells by homo- and heterocellular contacts and transfer genetic information and signaling molecules to influence other cells [1, 2]. Shoshkes-Carme et al. [3] recently demonstrated that TCs can be the major source of Wnt signaling, and play dependent roles in proliferation of intestinal stem cells and epithelial renewal. This particular study provides solid evidence that forkhead box L1-positive TCs contribute to the formation of the subepithelial plexus of the intestine, support the entire epithelium, and provide niche signals to intestinal stem cells, by producing Wnt ligands and maintaining Wnt signal pathway. Although TCs are often allocated within the stem cell niche, pulmonary TCs have different genetic profiles and biological functions from stem cells, fibroblasts, alveolar type II cells, airway basal cells, proximal airway cells, and T cells from bronchial lymph nodes or from lungs, respectively [47]. TCs functionally and constructively support and connect tissue cells, function as signal massage carriers, and benefit gene and cell therapies [812].

Gene modification is considered as a potential therapy to genetically prevent and treat diseases, even though a large number of factors still need to furthermore clarified, e.g. safety, efficacy, and complexity. With rapid development of gene editing technology, the precision and efficacy of gene modification are improved significantly [13, 14]. Safety profiles of gene modification as part of limitations require more preclinical and clinical evidence. The present study investigates potential effects of gene modification on morphological phenomes, biological behaviors and functions, as well as responses to inflammation in lung TCs. An anti-aging gene from Simian vacuolating virus 40 was transferred as the target gene into primary TCs isolated from mouse lungs to improve the longevity of cells, since primary TCs hardly survive in the in vitro system for a few weeks or months [57].

Materials and methods

TCs isolation and primary cell culture

Mice were provided by Animal Facility in Biomedical Research Center of Zhongshan Hospital, Fudan University. This study was approved by the Fudan University Ethical Committee for animal experiments.

Mouse lung TCs were isolated and prepared as escribed previously [4]. In brief, female BABL/c mice aged 6–8 weeks were used and anaesthetized. The trachea and lung tissues were isolated and collected into sterile tubes, containing Dulbecco’s Modified Eagle’s Medium plus F12 (DMEM/F12) integration (Gibco, NY, USA), supplemented with 100 UI/ml penicillin, 0.1 mg/ml streptomycin (Sigma-Aldrich Shanghai Trading Co Ltd., Shanghai, China). Samples were placed on ice and transported to the cell culture laboratory within 30 min. The tissues were cut into about 1 × mm3 in sterile DMEM/F12 and incubated in 10 mg/ml collagenase type II (Sigma-Aldrich, St. Louis, MO, USA) and 2000 U/ml deoxyribonuclease I (Sigma-Aldrich) on an orbital shaker for 4 h, at 37 °C. Cell suspension was separated by 40-m-diameter cell strainer (BD Falcon, NJ, USA), and dispersed cells were collected by centrifugation. Cells were resuspended in DMEM/F12, supplemented with 10% fetal calf serum, 100 UI/ml penicillin, 0.1 mg/ml streptomycin (Sigma-Aldrich), and cultured in a incubator, with 5% CO2 in air, at 37 °C, for 30 min, to wipe off most fibroblasts. Cell suspension was transferred to other flakes and cultured for another 12 h before changing culture medium. Culture medium was changed every 48 h. Cells were examined by phase contrast microscope, under an inverted Olympus phase contrast microscope (1 × 51; Tokyo, Japan).

Lentivirus construction and infection

Lentivirus particles containing the small and large T antigen of anti-aging gene from Simian vacuolating virus 40 (SV40) gene were constructed (HanyinCo., Shanghai, China) according to the former articles [15]. The oligo (listed 5′–3′) SV40-F: CCG GAATTCATGGATAAAGTTTTAAACAGAGAGGAATC and SV40-R: GCTCTAGATTACAAGTCCTCTTCAGAAATGAG. TCs were infected on 6-well plates for 12 h at 37 °C, replaced fresh medium, and harvested for qPCR analysis to determine the SV40 mRNA expression level after being cultured for 96 h at 37 °C.

RNA extraction and PCR

Primary TCs and TCs transformed with SV40 (TCsSV40) were seeded in 24-well plates with a density of 104 cells/well and cultured for 24 h at 37 °C. Cells were washed thrice with PBS, and total RNA was isolated and transcribed into single-stranded cDNA using the 1st Strand cDNA Synthesis Kit for RT-PCR (AMV, Roche) following the recommendations of the manufacturer.

cDNA was synthesized from 1 µg of total RNA using PrimeScript® RT reagent Kit (Takara Bio Inc., Shiga, Japan). PCR was performed with 1 µl of cDNA using GoTaq polymerase (Promega) for 25 cycles with specific primers for SV40. PCR reaction products were resolved and stained with Gelred (Biotium Inc., Newark, USA).

Detection of cell bio-behaviors

The bio-behaviors of TCs and TCsSV40 were recorded and analyzed using a Cell-IQ cell culturing platform (Chip-Man Technologies, Tampere, Finland), equipped with a phase-contrast microscope (Nikon CFI Achromat phase contrast objective with 10 magnification) and a camera20. The bio-behaviors, including cell proliferation, division, death, cell morphology, and cell movement, can be monitored and recorded as time-lapse data by this Cell-IQ system uses machine vision technology. Images were captured at about 30 min intervals for 48 h. Analysis was carried out with a freely distributed Image software (McMaster Biophotonics Facility, Hamilton, ON), using the Manual Tracking plugin created by Fabrice Cordelie´res (Institute Curie, Orsay, France).

RNA microarrays and long non-coding RNA (lncRNA) classification pipeline

RNA microarrays and lncRNA classification pipeline were tested in primary TCs or TCsSV40. Briefly, total RNA was collected using NucleoSpin® RNA Plus according the manufacturer’s protocol (Macherey–Nagel, Inc., Düren, Germany). Microarray and quality controls of gene expression profiling were performed after RNA and cDNA amplifications, using the GeneChip® Human Transcriptome Array 2.0 gene chip (Affymetrix, Inc., UK) with 67,528 genes. Gene expression data from each group were analyzed using Expression Console and Transcriptome Analysis Console (Affymetrix). The differentially expressed mRNA and lncRNAs were used for a hierarchical clustering analysis (HCA) in Cluster and TreeView (

Immunofluorescent staining

Double immunofluorescent staining for CD34 and vimentin was performed as previously reported [21]. In brief, primary TCs or TCsSV40 in 1, 5, 10, 30, or 50 generations were load and cultured on glass bottom cell culture dishes with 20 mm diameter glass (NEST, Nanjing, China) and were fixed in 4% paraformaldehyde containing 0.05% Triton-X-100 for 20 min. The cells were washed thrice with PBS and blocked in 5% bovine serum albumin (BSA) for 1 h and incubated overnight at 4 °C with mouse anti-CD34 antibody and goat anti-vimentin antibody or rabbit anti-ckit antibody (1:200 dilution; Abcam, Cambridge, UK) diluted in 1% BSA in PBS. Cells were washed in PBS thrice and incubated with PE conjugated anti-goat secondary antibodies and FITC conjugated anti-rabbit secondary antibodies and/or FITC conjugated anti-mouse secondary antibodies (1:200 dilution; Jackson ImmunoResearch, USA). The nuclear were marked by DAPI staining, according to the manufacture’s instruction (KeyGEN BioTECH, Nanjing, China).

Transmission electron microscopy

The ultrastructure of cells were observed under transmission electron microscopy (TEM) as previously reported (14). In brief, primary TCs or TCsSV40 in 1, 5, 10, 30, and 50 generations were cultured, collected, and fixed in 4% glutaraldehyde (pH 7.3, 4 °C) for 4 h. Cells were then washed with 0.1 M cacodylate buffer and post-fixed with 1% osmium tetroxide in 0.1 M cacodylate buffer (pH 7.3, 4 °C). After fixing, cells were dehydrated in a graded series of ethanol, impregnated in propylene oxide (immersed overnight in a mixture of propylene oxide and Epon 812 resin), and embedded in Epon 812. Ultrathin sections at 70 nm were cut on a Leica LKB-II (Nußloch, Germany), collected on Formvar-coated copper grids, stained with uranyl acetate and lead citrate, and observed at an acceleration voltage of 80 kV electron microscope (JEOL JEM-1230, Tokyo, Japan).

Immunoelectron microscopy

Ultrathin sections were prepared and collected on nickel grids. Immunolabeling staining for CD34/Vimentin and ckit/platelet-derived growth factor receptor α (PDGFR-α) was used as previously reported [22]. In brief, sections were incubated in 50 mM Glycine for 30 min and washed in Ultra-pure Water thrice for 5 min. Sections were etched in 1% sodium periodate for 10 min following washing in Ultra-pure water. Sections were incubated in the blocking buffer for 20 min and labeled with rabbit anti-ckit antibody, mouse anti-CD34 antibody, goat anti-vimentin antibody and/or rat anti PDGFR-α antibody (1:200 dilution; Abcam) at 4 °C for 24 h. The nickel grids were washed in PBS for 5 min 12 times, blocked within 1% BSA for 20 min, and incubated with 10 nm gold conjugated anti-goat secondary antibodies, 18 nm gold conjugated anti-mouse secondary antibodies, 25 nm gold conjugated anti-rat secondary antibodies, and/or 40 nm gold conjugated anti-rabbit secondary antibodies (1:200 dilution; Abcam) for 2 h. Nickel grids were dried on filter paper and observed with transmission electronic microscopy (TEM). The staining controls included cells stained only with the second antibodies with gold labelling or the first antibodies.

Cell cycle assay

Propidium iodide (PI) staining was used for cell cycle analysis of primary TCs and TCsSV40 as described in manufacturer. In brief, cells were collected and fixed in 75% ethanol at 4 °C for overnight. After centrifuging and washing, staining buffer (BD Pharmingen, NJ, USA) with 0.5 ml PI/RNase was added to each tube for 15 min at room temperature. Samples were examined with a fluorescence-activated cell sorting flow cytometer (FACS Aria II, Becton, Dickinson and Company, NJ, USA) and DNA histograms were analyzed with Flowjo 7.6.1 software. Each test was repeated thrice.


Data were expressed as mean ± SEM analyzed using SPSS Statistics 20 (IBM, Chicago, USA). Statistical differences between two groups were compared by t-test. Statistical differences among more than two groups were determined using ANOVA. p value less than 0.05 was considered significant.


Telopodes (Tps) as one of characteristic structures of TCs were demonstrated in Fig. 1a, b. The c-kit/CD117, CD34 and vimentin in primary lung TCs were detected and shown in Fig. 1c, d, f–h. TEM tomography also showed that TCs have narrow and flat cellular prolongations surrounding other TCs in Fig. 1i, j. Mitochondria and endoplasmic reticulums in cytoplasm and nuclear of TCs were shown (Fig. 1k). Cytomembrane were also shown clearly under TEM (Fig. 1l).
Fig. 1
Fig. 1

Characteristics of primary lung telocytes (TCs). a, b Telocytes with telopodes (black arrow heads), c positive staining of c-kit (green), and telopodes (white arrow heads), d positive staining CD34 (green), and telopodes (white arrow heads), e nuclear staining with DAPI, f positive staining of vimentin (red), g positive staining of CD34 (green), h merge of DAPI, vimentin, and CD34, i telopode ultrastructure (Tp), j organelle and cell membrane, k mitochondrial (black arrows), mitochondrial vacuoles (white arrow head) and endoplasmic reticulum (black arrow head) in the cytoplasm, and l microvilli under TEM

The quality of SV40 gene insert in TCsSV40 were defined with SV40 mRNA expression and shown in Fig. 2a. Characteristics of telocytes in TCsSV40 were identified and telopodes of TCsSV40 were observed and recorded in Fig. 2b. The positive staining of vimentin and CD34 was detected in primary lung TCs and TCsSV40, as presented in Fig. 2c, d.
Fig. 2
Fig. 2

TCs characteristics of lung TCs transferred with SV40 (TCsSV40). a SV40 mRNA expression of TCsSV40 cells, as compared with primary lung TCs or SV40-negative cells, b telopodes of TCsSV40 at 2 (b1), 5 (b2), 10 (b3), or 20 generations (b4), c positive staining of c-kit (green) in TCsSV40 at 2 (c1), 5 (c2), 10 (c3), or 20 generations (c4), d positive staining of CD34 (green) in TCsSV40 at 2 (d1), 5 (d2), 10 (d3), or 20 generations (d4), and e positive staining of CD34 (green) and vimentin (red) in TCsSV40 at 2 (e1), 5 (e2), 10 (e3), 20 (e4), 30 (e5), 40 (e6), 50 (e7), or 60 generations (e8), where cell nuclei were stained with DAPI

In order to demonstrated the immortalization and stability of TCsSV40, telopodes were observed in TCsSV40 cultured for 1, 5, 10 and 20 generations SV40 mRNA positively expressed in TCsSV40 cells through generations, as compared with primary lung TCs or SV40-negative cells (Fig. 2a). Characteristics of TCsSV40 were furthermore evaluated at 2, 5, 10, or 20 generations, respectively, including telopodes (Fig. 2b1–b4), positive staining of c-kit (Fig. 2c1–c4), positive staining of CD34 (Fig. 2d1–d4), or positive staining of both CD34 and vimentin at 2 (e1), 5 (e2), 10 (e3), 20 (e4), 30 (e5), 40 (e6), 50 (e7), or 60 generations (e8), where cell nuclei were stained with DAPI. Dynamic alterations of TCsSV40 at 2, 5, 10, 20, 30, 50, or 60 generations were recorded automatically each 30 min for 48 h and cell morphological phenomes were presented each 12 h, respectively, in Additional file 1: Figure S1. Figure 3 demonstrated that immuno-positive staining of the vimentin labeled with particle diameter at 10 nm, CD34 at18 nm, platelet-derived growth factor receptor α (PDGFRα) at 25 nm, or ckit at 40 nm in lung TCsSV40 under transmission electronic microscopy. Tomography of TCs was taken immediately after transfer with SV40 tomography, to show mitochondria-rich cytoplasm and surrounded nucleus as well as telopodes with mitochondria (Fig. 3a). PDGFRα, ckit, or vimentin and CD34 were easily detected in TCsSV40 at 2 (b, c, d), 5 (e, f), 10 (g, h), 30 (i, j), or 50 generations (k, l), respectively. Those findings of transmission electronic microscopy tomography expression demonstrated that the characteristic structures and expressions of specific markers could be stable and consistent until generation 60.
Fig. 3
Fig. 3

Immuno-staining transmission electronic microscopy tomography of vimentin, CD34, platelet-derived growth factor receptor α (PDGF), or ckit of lung TCs transferred with SV40 (TCsSV40). a TCsSV40 tomography, and positive staining of vimentin ( , 10 nm), CD34 ( , 18 nm), PDGF ( , 25 nm), or ckit ( , 40 nm) in TCsSV40 at 2 (bd), 5 (e, f), 10 (g, h), 30 (i, j), or 50 generations (k, l)

The profiles of transcriptional factor and lncRNA genes between primary lung TCs and TCsSV40 were compared and listed in Tables 1 and 2, and the hotmap was shown in Fig. 4. As compared with purified primary lung TCs, 367 or 621 genes were up- or down-regulated in purified TCsSV40, 668 or 890 genes in non-purified lung TCsSV40, or 36 genes up-regulated in non-purified primary lung TCs. As compared with non-purified TCsSV40, 71 or 116 genes were up- or down-regulated in purified TCsSV40. Details of transcriptional factor and lncRNA gene profiles were listed in Additional file 2: Table S1. COL3A1 and SFRP2, which code alpha 1 type III collagen and secreted frizzled-related protein 2, respectively, significantly up-regulated in purified TCsSV40, as compared with purified primary lung TCs. The patterns of transcriptional factor and lncRNA gene profiles were shown in Fig. 4a, b, respectively). The top 5 transcriptional factor genes are COL3A1, SLIT3, FST, NNAT and PCDH17, respectively. The top 5 lncRNA genes are TC17000728.hg.1, TC06001978.hg.1, TC08000302.hg.1, TC07001784.hg.1 and TC03003114.hg.1, respectively.
Table 1

Summary of mRNA expressed preferentially in primary TCs, SV40-transformed TCs, primary lung cells, and SV40-transformed primary lung cells

Compared pairs

Up > 0

Up > 2

Down > 0

Down > 2

Purified TCsSV40 vs. non-purified primary lung TCs





Non-purified lung TCsSV40 vs. purified primary lung TCs





Non-purified lung TCsSV40 vs. non-purified primary lung TCs





Purified TCsSV40 vs. non-purified lung TCsSV40





Purified TCsSV40 vs. purified primary lung TCs





Purified primary lung TCs vs. non-purified primary lung TCs





Gene symbol or probe set ID

Fold change


Gene feature

(A) Genes up/down-regulated in purified TCsSV40 compared with non-purified primary lung TCs


















−  1.82768












− 1.342675




− 1.502786
























− 1.653323








− 1.354523




− 1.46284








− 1.391618












− 1.562517












− 1.658072












− 1.334035
























− 1.536647




− 1.263978








− 1.620988




− 1.252673




















− 1.302994




















− 1.297559




− 1.339824




− 1.251508








− 1.222378








− 1.262105
























− 1.383183








− 1.211023








− 1.227564
























− 1.243142








− 1.254073




− 1.296542




− 1.348845




− 1.213445




− 1.381268












− 1.339568












− 1.406503




− 1.31031




















− 1.26922








− 1.26636




















− 1.282448




















− 1.345451












− 1.372487




− 1.2362








































− 1.288423




















− 1.275263








− 1.446989








− 1.240478
























− 1.775002




− 1.217215








− 1.202425




− 1.218305




− 1.309717








− 1.201507




− 1.219609












− 1.426169












− 1.472338








− 1.28931




− 1.402432




− 1.228703








− 1.348087




− 1.305233




− 1.441636




− 1.297173












− 1.251764












− 1.249464












− 1.286372








− 1.223213




− 1.395397








− 1.266513




− 1.226605








− 1.316949




− 1.217861




− 1.289373








− 1.388434
















− 1.266045




− 1.207326








− 1.300464




− 1.306757
















− 1.260531




















− 1.236782








− 1.223153




− 1.347429




− 1.265769




− 1.203962




















− 1.329997




− 1.209603








− 1.203287




− 1.216676




− 1.219439




− 1.236803












− 1.214996








− 1.203628








− 1.274955












− 1.224248




− 1.206554












− 1.289738




− 1.227643




− 1.274058




− 1.205937




− 1.234126




− 1.272615




− 1.295252








− 1.236736




− 1.205245




− 1.307114




− 1.205287




− 1.224805




















− 1.200287




− 1.226812




− 1.248056







IGKV3− 11

− 1.238746












− 1.350099




− 1.22367




− 1.332179












− 1.216419




− 1.327135




− 1.438272




− 1.206156
















− 1.244558








− 1.233366








− 1.287342








− 1.224446




− 1.256007












− 1.29591












− 1.224684




− 1.200256
















− 1.222753




− 1.230342
















− 1.325127











Gene symbol

Fold change


Gene feature

(B) Genes up/down-regulated in non-purified lung TCsSV40 compared with purified primary lung TCs










































































− 1.428542












− 1.432059








− 1.376913












































− 1.206501




























− 1.332419
























































− 1.275386








− 1.275203




− 1.599369




















































− 1.490493








− 1.218811




− 1.253647








− 1.209259




















− 1.352419








− 1.233749








− 1.26885




























































































− 1.274947




























− 1.379974
































− 1.217838




− 1.632353








− 1.318245




























−  1.21677








− 1.222991




















− 1.260078












− 1.252339




− 1.255715








− 1.295109








− 1.270503








− 1.268008




























































− 1.206701




































− 1.418505
































− 1.219252




















































− 1.257624
















− 1.247787












− 1.443858












− 1.223928
















































− 1.210825




− 1.210825








− 1.237852




































− 1.539904












































− 1.357705
















− 1.340511












− 1.249904












− 1.244805
































− 1.284699












− 1.308229




















− 1.247925








− 1.225147












− 1.28009












− 1.279773
















































− 1.253194




− 1.331709












− 1.247281




− 1.384833








− 1.273558




− 1.247386




























− 1.222095












− 1.208645
















− 1.229146




























− 1.348061




















− 1.261057
















− 1.253518




































− 1.612969
















− 1.280949








− 1.222558












− 1.248052








− 1.226576








− 1.251288








− 1.215537
























− 1.307921
















− 1.247763




− 1.210053












































− 1.226509








− 1.233065




− 1.285309
















− 1.250913








− 1.204976




















− 1.206131




− 1.297287




− 1.220789








− 1.273131








− 1.267673




− 1.275722












− 1.263243




− 1.263243








− 1.249936








− 1.217568








− 1.215171




− 1.215548




− 1.213104




− 1.258226












− 1.226136








− 1.238928








− 1.354102




− 1.208467








− 1.252699




− 1.252699




− 1.252699




− 1.201599












− 1.205771
















































− 1.216993




− 1.213705




− 1.205295








− 1.226557








− 1.229097








− 1.229216








− 1.327872




− 1.212834












− 1.234909




− 1.270079




− 1.33934




− 1.236353




− 1.234952








− 1.208788




− 1.271706




− 1.231414




− 1.207195








− 1.236716




− 1.203294




− 1.256974











Gene symbol

Fold change


Gene feature

(C) Genes up/down-regulated in non-purified lung TCsSV40 compared with non-purified primary lung TCs










− 1.711607




































− 1.461747
















− 1.423327




− 1.306238




− 1.263174








− 1.307252












− 1.373795
































− 1.310532




















− 1.617275




− 1.239617




− 1.932881




− 1.657267




− 1.442975








− 1.327861












− 1.360214












− 1.353459




− 1.351938




− 1.269111




















































































− 1.263137




− 1.307128








− 1.212789




− 1.350686
















− 1.274332












− 1.241703




















− 1.280112












− 1.219414




− 1.36697








− 1.294519




− 1.34803




















− 1.519776












− 1.246466




− 1.356633




































− 1.227122




































− 1.204723




− 1.228557








































− 1.386832








− 1.233077




− 1.289174




− 1.222678




























− 1.206393
















− 1.216959








− 1.210057












− 1.413218
























− 1.231349




− 1.298692




− 1.284827








− 1.240495












− 1.253787








− 1.327418




− 1.208364




− 1.227094




− 1.277907








− 1.473668
















− 1.348394








− 1.209186




















− 1.304855




− 1.210708




− 1.278784












− 1.419463




− 1.386141








− 1.226269




− 1.226269












− 1.336272




− 1.231192
































− 1.370641




− 1.229163
















− 1.350334




































− 1.20559




















− 1.235944




− 1.239367








− 1.309184




− 1.298345












− 1.386398




− 1.251192




− 1.238425








− 1.397758
















− 1.335922




− 1.335922




− 1.24485








− 1.383088








− 1.355331
















− 1.258635
























− 1.331198




− 1.331198




− 1.331198




























− 1.20247












− 1.237888




− 1.519734
















− 1.244628




− 1.225571




















− 1.203425












− 1.243194












− 1.356188












− 1.200225












− 1.206951








− 1.216805




− 1.289554








− 1.219406












− 1.294084












− 1.203066
















− 1.210771












− 1.231653




− 1.34441




− 1.226358












− 1.23126












− 1.24305








− 1.25219
















− 1.254685








− 1.207411




− 1.253243








− 1.583233




































− 1.217544








− 1.34524




















− 1.246936




− 1.257301












− 1.236121




− 1.317909












− 1.200801




− 1.207171




































− 1.31544
























− 1.332138








− 1.226511




























− 1.261291




− 1.297342




− 1.247986
















− 1.202154




− 1.222393




− 1.251225




− 1.224599








− 1.228863




− 1.209919




− 1.389386












− 1.207255












− 1.206125
















− 1.209012




− 1.209466




− 1.220919




− 1.257586




− 1.224177








− 1.281085




− 1.213396




− 1.227139
























− 1.272609




− 1.202663




− 1.231507




− 1.209384




− 1.220835




− 1.26804




− 1.205738








− 1.251899








− 1.220859















Gene symbol

Fold change


Gene feature

(D) Genes up/down-regulated in purified TCsSV40 compared with non-purified lung TCsSV40


− 1.554972




− 1.541494




− 1.518909




− 1.5017




− 1.495358




− 1.460638




− 1.423681




− 1.421299




− 1.415118




− 1.409588




− 1.404048




− 1.396899




− 1.384761




− 1.366172




− 1.360048




− 1.354049




− 1.34869




− 1.348486




− 1.344601




− 1.344027




− 1.322403




− 1.309011




− 1.308399




− 1.307068




− 1.302327




− 1.298157




− 1.293984




− 1.292011




− 1.288509




− 1.286961




− 1.285024




− 1.283244




− 1.277447




− 1.272748




− 1.269844




− 1.269255




− 1.268694




− 1.265588




− 1.265153




− 1.258982




− 1.253813




− 1.25119




− 1.249545




− 1.249169




− 1.24814




− 1.247444




− 1.247099




− 1.244124




− 1.239348




− 1.237186




− 1.235005




− 1.233364




− 1.232684




− 1.232013




− 1.230287




− 1.229069




− 1.229057




− 1.228348




− 1.227886




− 1.224725




− 1.224506




− 1.222428




− 1.221814




− 1.218558




− 1.217315




− 1.216913




− 1.211676




− 1.209973




− 1.209927




− 1.209539




− 1.207964




− 1.206718




− 1.20442




− 1.20254




− 1.201293



































































































































































































































































Gene symbol

Fold change


Gene feature

(E) Genes up/down-regulated in purified TCsSV40 compared with purified primary lung TCs






















































− 1.299299




































































































− 1.43313








− 1.417133




























































− 1.345805












− 1.277385








− 1.366576
























− 1.413812












− 1.307768
















































− 1.543509












































− 1.200632












− 1.393924
















− 1.318507








− 1.270642








− 1.258022
















− 1.215588




− 1.564357








− 1.778186




















− 1.242627












− 1.214763




























− 1.247945




− 1.252561




























− 1.416186




− 1.257686




− 1.26446




− 1.352471








− 1.574397








− 1.325378








− 1.20015












− 1.35926








− 1.206907












− 1.224408




































− 1.231871




− 1.40635








− 1.307951








− 1.240302




− 1.252354




























− 1.218394




















− 1.215306




− 1.44934




− 1.311667












− 1.617442




− 1.394869
















− 1.41599
















− 1.208493








− 1.36196








− 1.289217
















− 1.432868








− 1.307225




− 1.204892




− 1.249159
















− 1.279406












− 1.235799












− 1.344862




































− 1.284147
















− 1.25044




− 1.254142








− 1.306901












− 1.22658




− 1.275752




− 1.22599




− 1.288077












− 1.215737








− 1.377121




























− 1.230659








− 1.256973








− 1.219622




























− 1.260641




− 1.26699




























− 1.209083












− 1.240781








− 1.295132




























− 1.207714




− 1.208847












− 1.236566




− 1.267039




− 1.258083








− 1.270263




− 1.208922












− 1.219365




− 1.210453












− 1.205359




− 1.200483




− 1.217294




− 1.354502




− 1.213158








− 1.234805








− 1.260932




− 1.278428




− 1.246149








− 1.203819




− 1.226413




− 1.331489












− 1.205193
















− 1.202169








− 1.302317












− 1.263183




















− 1.227983




− 1.31152




− 1.305497




− 1.245443












− 1.208949




− 1.21805








− 1.233615




− 1.225907








− 1.24424




− 1.209642












− 1.227022












− 1.206284




− 1.211827








− 1.287169
















− 1.204566




− 1.304006
















− 1.200157




− 1.246053












− 1.202141








− 1.23782








− 1.200102












− 1.206482




− 1.332407




− 1.236963




− 1.216059








− 1.31215



















Gene symbol



Gene feature

(F) Genes up/down-regulated in purified primary lung TCs compared with non-purified primary lung TCs





























































































Table 2

Summary of LncRNA expressed preferentially in primary TCs, SV40-transformed TCs, primary lung cells, and SV40-transformed primary lung cells

Compared pairs

Up > 0

Up > 2

Up > 4

Down > 0

Down > 2

Down > 4

Purified TCsSV40 vs. non-purified primary lung TCs







Non-purified lung TCsSV40 vs. purified primary lung TCs







Non-purified lung TCsSV40 vs. non-purified primary lung TCs







Purified TCsSV40 vs. non-purified lung TCsSV40







Purified TCsSV40 vs. purified primary lung TCs







Purified primary lung TCs vs. non-purified primary lung TCs







Probe set ID

Fold change


Gene feature

(A) Genes up/down-regulated in SV40-transformed TCs compared with non-purified primary lung TCs


− 3.568496




− 2.084397




− 1.909385




− 1.941664








− 5.521638




− 2.006316




− 2.008375




− 1.75485




− 1.817337




− 2.1972




− 2.098063




− 3.102457




− 1.660071




− 2.429971




− 1.575753




− 1.965258




− 2.054482




− 1.795968




− 2.05885




− 1.786234




− 1.864315




− 1.653172




− 1.966802




− 1.570089




− 1.634325




− 1.709011




− 1.6597




− 1.773582




− 2.600896








− 1.643102




− 1.698079




− 1.705076




− 1.840391




− 1.803182




− 1.642511




− 1.59482








− 1.813744












− 1.694023




− 2.085812












− 1.523167




− 1.641514




− 1.690876




− 2.460055




− 1.512893




− 1.794425




− 1.623728








− 1.52185




− 1.610212




− 1.687945




− 1.462384








− 1.497291




− 1.45832








− 1.532716




− 1.709435




− 2.223119




− 1.571049




− 1.460727




− 1.884772




− 1.617606




− 1.506318




− 1.58983




− 1.551407








− 1.567348




− 1.404635




− 1.492016




− 1.432959












− 1.597171




− 1.529742








− 1.399794




− 1.925543




− 1.3817




− 1.499786




− 1.569494




− 1.760166




− 1.64911




− 1.818282




− 1.514532




− 1.536016








− 1.561318








− 1.626193




− 1.447509




− 1.43228




− 1.367414




− 1.434151








− 1.370893




− 1.537691




− 1.513117




− 1.610494




− 1.353733












− 1.397728




− 1.579598




− 1.38553




− 1.386582




− 1.504601




− 1.609811




− 1.520125




− 1.436957








− 1.497563




− 1.526196








− 1.445488




− 1.576476




− 1.493934




− 5.95641




− 1.77144




− 1.417269




− 1.558205












− 1.300817








− 1.387042




− 1.911084




− 1.495234








− 1.504051




− 1.579594












− 1.487896




− 1.488885




− 1.669152




− 1.861195




− 1.472401








− 1.543233




− 1.312105




− 1.554705








− 1.321197












− 1.306114








− 1.314749




− 1.561996




− 1.54477




− 1.522336








− 1.423964




− 1.264085




− 1.366729




− 1.336156








− 1.372948




− 1.559039








− 1.351391




− 1.276702




− 1.76836




− 1.500158




− 1.464123




− 1.43654




− 1.883715




− 1.397564




− 1.409308












− 1.575078




− 1.412607




− 1.574012




− 1.487709




− 1.30562




− 1.342755




− 1.245674




− 1.665398




− 1.550585




− 1.384528




− 1.465004




− 1.483501




− 1.294238




− 1.414502








− 1.407878
















− 1.43278








− 1.411719




− 1.365813




− 1.456782




− 1.412488








− 1.318518




− 1.355328








− 1.297482




− 1.300852




− 1.312834








− 1.534637




− 1.438895




− 1.605406




− 1.313819




− 1.621814




− 1.621814








− 1.255062




− 1.408438




− 1.345698




− 1.25784












− 1.516075




− 1.55017




− 1.464825




− 1.21553




− 1.266846








− 1.387294




− 1.517692




− 1.343015




− 1.548066




− 1.411515




− 1.32531




− 1.223116




− 1.258521




− 1.568292




− 1.241694








− 1.474463




− 1.466781




− 1.381715




− 1.222626




− 1.398297








− 1.395271








− 1.481066








− 1.450196




− 1.372256




− 1.367369




− 1.229624




− 1.25784




− 1.345182




− 1.40134








− 1.350561








− 1.459511




− 1.221974




− 1.342571




− 1.363644




− 1.526047




− 1.256608




− 1.967375




− 1.315911




− 1.466612




− 1.444517




− 1.396169




− 1.459449




− 1.239977




− 1.208647








− 1.286344




− 1.467848




− 1.516537




− 1.288095




− 1.262033




− 1.270008




− 1.379802








− 1.231765




− 1.461504
















− 1.443029




− 1.489108








− 1.222474




− 1.537172








− 1.26419




− 1.387482








− 1.298179




− 1.293079




− 1.788733




− 1.237867












− 1.326114




− 1.464508




− 1.540151




− 1.364479




− 1.269107








− 1.280663




− 1.322208




− 1.209848




− 1.497029








− 1.321069








− 1.221883












− 1.246738








− 1.243931








− 1.21549




− 1.270448




− 1.230721








− 1.213079




− 1.208988








− 1.318377




− 1.439342




− 1.204212




− 1.269006








− 1.319501




− 1.314131




− 1.409573




− 1.264853








− 1.253982




− 1.272432




− 1.200546








− 1.421401




− 1.353943




− 1.376088




− 1.262026




− 1.233191




− 1.263829




− 1.216333




− 1.41643




− 1.273853




− 1.237444




− 1.232303




− 1.318296




− 1.294835




− 1.390182




− 1.279341




− 1.347061




− 1.457383




− 1.342035




− 1.247279




− 1.611347




− 1.294863




− 1.575981




− 1.261765




− 1.21386




− 1.308938




− 1.336301




− 1.549747




− 1.251394




− 1.249078




− 1.293203




− 1.291408




− 1.497742




− 1.417707




− 1.537348




− 1.242118




− 1.327132




− 1.384112




− 1.216393




− 1.316901




− 1.31262




− 1.360527




− 1.226402




− 1.281421




− 1.397268




− 1.21053




− 1.264325




− 1.277746




− 1.202124




− 1.2066




− 1.536921




− 1.319732




− 1.239263




− 1.422263




− 1.3743




− 1.259432




− 1.222783




− 1.318867




− 1.267134




− 1.256931




− 1.278303




− 1.361963




− 1.234314




− 1.30431




− 1.343934




− 1.236027




− 1.225856




− 1.255489




− 1.273889




− 1.452174




− 1.324442




− 1.228785




− 1.338948




− 1.221816




− 1.301327




− 1.298316




− 1.312801




− 1.267211




− 1.366098




− 1.28573




− 1.273221




− 1.376529




− 1.244225




− 1.250802




− 1.217863




− 1.310615




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.223489




− 1.478844




− 1.312238




− 1.285007




− 1.329768




− 1.272863




− 1.275857




− 1.345262




− 1.226194




− 1.347505




− 1.385031




− 1.237854




− 1.228885




− 1.244544




− 1.312764




− 1.363667




− 1.411292




− 1.291451




− 1.233983




− 1.226019




− 1.222774




− 1.241196




− 1.530933




− 1.28848




− 1.306143




− 1.260067




− 1.251909




− 1.376805




− 1.252071




− 1.352134




− 1.27015




− 1.297266




− 1.790883




− 1.273087




− 1.295919




− 1.28801




− 1.341757




− 1.200639




− 1.503979




− 1.322513




− 1.235461




− 1.275671




− 1.232224




− 1.281014




− 1.439696




− 1.200347




− 1.216715




− 1.266825




− 1.302501




− 1.259762




− 1.211289




− 1.262158




− 1.242348




− 1.287548




− 1.220964




− 1.226388




− 1.204095




− 1.209995




− 1.217144




− 1.259755




− 1.534217




− 1.319697




− 1.208333




− 1.381912




− 1.310737




− 1.273032




− 1.306173




− 1.209813




− 1.230499




− 1.228074




− 1.242578




− 1.21474




− 1.260137




− 1.266336




− 1.246934




− 1.248587




− 1.393997




− 1.417426




− 1.251152




− 1.256604




− 1.285385




− 1.252245




− 1.237299




− 1.273649




− 1.485667




− 1.485667




− 1.485667




− 1.485667




− 1.485667




− 1.485667




− 1.485667




− 1.485667




− 1.377767




− 1.303647




− 1.254488




− 1.250815




− 1.230333




− 1.305785




− 1.225331




− 1.214327




− 1.33252




− 1.227667




− 1.204106




− 1.244625




− 1.223768




− 1.298135




− 1.206244




− 1.401887




− 1.211724




− 1.227037




− 1.218277




− 1.254429




− 1.282112




− 1.287577




− 1.33179




− 1.416389




− 1.283492




− 1.22617




− 1.215328




− 1.263185




− 1.230616




− 1.241843




− 1.250366




− 1.260255




− 1.232297




− 1.215891




− 1.258765




− 1.241108




− 1.303591




− 1.200106




− 1.215571




− 1.212141




− 1.373017




− 1.214059




− 1.230783




− 1.232531




− 1.272763




− 1.316727




− 1.390197




− 1.227836




− 1.228079




− 1.277552




− 1.329442




− 1.350724




− 1.279519




− 1.200612




− 1.202026




− 1.339589




− 1.233888




− 1.204559




− 1.245733




− 1.216687




− 1.202026




− 1.245568




− 1.202092




− 1.356607




− 1.246169




− 1.243627




− 1.215974




− 1.253239




− 1.293355




− 1.213308




− 1.239214




− 1.255784




− 1.236896




− 1.344018




− 1.206352




− 1.201822




− 1.237207




− 1.328568




− 1.261482




− 1.211536




− 1.271102




− 1.217988




− 1.253176




− 1.259466




− 1.299097




− 1.415817




− 1.203564




− 1.365244




− 1.254194




− 1.276394




− 1.253291




− 1.261791




− 1.21877




− 1.210002




− 1.200871




− 1.311616




− 1.30518




− 1.219978




− 1.256127




− 1.204404




− 1.213954




− 1.212198




− 1.239784




− 1.229291




− 1.281049




− 1.441811




− 1.228168




− 1.246788




− 1.302083




− 1.274389




− 1.233444




− 1.248432




− 1.259327




− 1.216984




− 1.434725




− 1.250337




− 1.286012




− 1.208537




− 1.246345



Probe set ID

Fold change


Gene feature

(B) Genes up/down-regulated in non-purified lung TCsSV40 compared with purified primary lung TCs














− 2.174193




− 2.453481
















− 2.038322




− 1.75483




− 1.873134




− 1.779116












− 1.822189








− 2.011887




− 2.097234




− 1.962423




− 2.143818




− 1.928676








− 2.062837




− 2.085546




− 1.915437




− 1.936021




− 1.951298




− 1.714082




− 1.960068












− 1.762113




− 1.74863




− 1.57464




− 1.815099




− 1.890235








− 2.886542








− 1.606168




− 1.770781




− 1.882465








− 1.742013








− 1.540303




− 2.094361




− 1.589254




− 1.788577








− 1.578384












− 1.528388








− 1.534991




− 1.538502




− 1.841917




− 1.669996




− 1.351113




− 1.638782




− 1.558447




− 1.603015




− 1.406478








− 1.476476




− 1.357936




− 1.683139








− 1.782594








− 1.508486




− 1.524343




− 1.409684




− 1.497175




− 1.555849




− 1.510761




− 1.585855




− 1.471839




− 1.563519




− 1.527689








− 1.606186












− 1.472924




− 1.415531




− 1.52073




− 2.149662




− 1.792384




− 1.443667








− 1.497583




− 1.728642








− 1.378512




− 1.569396




− 1.548005




− 2.249923




− 1.560574




− 1.589272




− 1.413369




− 1.593632




− 1.603841




− 1.56613








− 1.50307




− 1.798942




− 1.526505




− 1.571098




− 1.737066








− 1.689071




− 1.53535




− 1.463791








− 1.430525




− 1.579571




− 1.395094




− 1.680036








− 1.511784




− 1.472641




− 1.557636












− 1.391194




− 1.401112




− 1.399246








− 1.880185




− 1.563391




− 1.690386








− 1.686971








− 1.965686








− 1.430809




− 1.617304




− 1.515315




− 1.459227




− 1.49803




− 1.685657




− 1.50861




− 1.500063












− 1.374202








− 1.53592








− 1.427752








− 1.48023




− 1.480003




− 1.545286




− 1.890718




− 1.631206




− 1.43066












− 1.26258












− 1.4237




− 1.316801
















− 1.455529








− 1.316062




− 1.597844




− 1.574349
















− 2.279339




− 1.779567








− 1.448026








− 1.412204








− 1.290438












− 1.475197




− 1.389715








− 1.347908




− 1.437374




− 1.463022




− 1.33117




− 1.355381




− 1.4849








− 1.607894




− 1.335439




− 1.337671




− 1.330873




− 1.325366




− 1.274316








− 1.487855




− 1.480823








− 1.387345




− 1.369026








− 1.676926




− 1.254769








− 1.439366




− 1.439366




− 1.447738




− 1.576693




− 1.203418




− 1.330718




− 1.664198
















− 1.411787




− 1.477672








− 1.29272




− 1.412674












− 1.402838




− 1.74914








− 1.281487




− 1.537328




− 1.483305




− 1.432026




− 1.487139




− 1.472423




− 1.596058








− 1.615791








− 1.422938








− 1.432311




− 1.283493




− 1.29301












− 1.361116








− 1.48138




− 1.390426




− 1.302759




− 1.470658








− 1.274852




− 1.220968
















− 1.72284




− 1.30756




− 1.261062












− 1.270974




− 1.399388




− 1.270101




− 1.473539












− 1.357028




− 1.250451








− 1.203628




− 1.272182




− 1.22311




− 1.294734




− 1.386049








− 1.437338








− 1.2404




− 1.204547




− 1.230721








− 1.343701




− 1.43499




− 1.286319




− 1.334931
















− 1.402437








− 1.30455




− 1.264527




− 1.348682








− 1.467195




− 1.214045




− 1.280838




− 1.280838












− 1.215286












− 1.277322




− 1.39417








− 1.248912




− 1.335358




− 1.280423




− 1.445879




− 1.497939








− 1.277646




− 1.58654




− 1.369976




− 1.606025












− 1.55743




− 1.292272








− 1.237744












− 1.253762








− 1.252655




− 1.338176




− 1.441623




− 1.339535












− 1.235444








− 1.684105




− 1.33301












− 1.359918








− 1.302308




− 1.340418




− 1.675618




− 1.550874












− 1.230537




− 1.353839








− 1.331955




− 1.25135




− 1.383993








− 1.385647




− 1.378694




− 1.31176




− 1.386422
















− 1.387138












− 1.354181
















− 1.28868








− 1.291715




− 1.506351




− 1.78159




− 1.278246




− 1.323654








− 1.298125




− 1.393313




− 1.289514








− 1.283611
















− 1.254125








− 1.439065




















− 1.233679




− 1.359631




− 1.318744








− 1.429617




− 1.484736




− 1.342651
























− 1.301706




− 1.245012








− 1.283389




− 1.262713








− 1.398601
















− 1.278397




















− 1.351627




− 1.316949




− 1.298179








− 1.27089








− 1.275897




− 1.346581








− 1.424301
















− 1.265554




− 1.479308




− 1.20304




− 1.305775








− 1.794386




− 1.213016








− 1.244999








− 1.20032




















− 1.515784




− 1.507259




− 1.281883




− 1.220035




− 1.269599
















− 1.307892




− 1.230563




− 1.247948








− 1.255584




− 1.438176




− 1.301601








− 1.281904








− 1.231238




− 1.326731




− 1.232379








− 1.281757




− 1.214252




− 1.22681








− 1.378763








− 1.384428




− 1.261884




− 1.349595




− 1.203688




















− 1.289242








− 1.251934
















− 1.242144












− 1.23458




− 1.413337




− 1.250738




− 1.215293








− 1.38887




− 1.413469




− 1.207228




− 1.251876




− 1.358753








− 1.384996




− 1.262382




− 1.271144
















− 1.220085




− 1.514096








− 1.256589




− 1.243073




− 1.22335




− 1.280267




− 1.500832








− 1.258358




− 1.273233








− 1.313791




− 1.309682








− 1.372422




− 1.201915








− 1.248919




− 1.415789




− 1.359798












− 1.253355




− 1.303562








− 1.271684








− 1.270957




− 1.204519




− 1.323404




− 1.23358




− 1.718844




− 1.211196




− 1.269449




− 1.319933
















− 1.284332




− 1.38294




− 1.296343








− 1.279966
















− 1.28452




− 1.245035
















− 1.312322




− 1.357252












− 2.439349




− 1.240737




− 1.244021




− 1.700442




− 1.268654








− 1.525018
















− 1.356168




− 1.296443




− 1.472614




− 1.212754








− 1.239402
































− 1.288544




− 1.321635




− 1.205232












− 1.374031








− 1.498561




− 1.337119
















− 1.331486




− 1.221462








− 1.275317




− 1.333711








− 1.368856




− 1.340035




− 1.256137




− 1.207418








− 1.204102








− 1.237973








− 1.247147




− 1.377179




− 1.211631




− 1.264613




− 1.215502








− 1.324115








− 1.326523












− 1.353026
























− 1.225872




− 1.220912




− 1.336503








− 1.248588




− 1.209515




− 1.231307




− 1.351643




− 2.445831




− 1.320632




− 1.303665








− 1.277875




− 1.312141








− 1.344179








− 1.217553








− 1.235064




− 1.229315








− 1.203482




− 1.220846
















− 1.307368




− 1.316009




− 1.223516




















− 1.285666




− 1.234276








− 1.277381








− 1.286168








− 1.344703
















− 1.28947












− 1.2102




− 1.295829




− 1.281199












− 1.429192








− 1.206529




− 1.401452








− 1.272703












− 1.276086




− 1.26174












− 1.259569




− 1.205487




− 1.232463




− 1.211047




− 1.202365




− 1.224528








− 1.239947




− 1.69314




− 1.24146












− 1.20556




− 1.382564




− 1.267632












− 1.271637








− 1.232658




− 1.266053








− 1.216828




− 1.21244








− 1.31306




− 1.351691












− 1.286462




− 1.270823








− 1.318727




− 1.319864
















− 1.291058




− 1.367271




− 1.289989




− 1.293013












− 1.207147




− 1.26481




− 1.209099












− 1.315641




− 1.224392




− 1.2392




− 1.251246




− 1.270503




− 1.329862




− 1.274065




− 1.362446




− 1.238252




− 1.238252




− 1.331047




− 1.488884




− 1.20754




− 1.221615




− 1.398937




− 1.228478








− 1.280176




− 1.204846




− 1.214255
















− 1.353408




− 1.29275




− 1.209774








− 1.296602












− 1.325403












− 1.282082








− 1.256837




− 1.229231




− 1.279981








− 1.235207
















− 1.235816












− 1.330246












− 1.200596




− 1.375037




− 1.307516




− 1.290744




− 1.232763




− 1.245515




− 1.22412




− 1.276668




− 1.258491




− 1.347036




− 1.210161




− 1.278329




− 1.201581




− 1.260934




− 1.261472




− 1.31615




− 1.20209




− 1.269749




− 1.20719




− 1.364074




− 1.224753




− 1.238846




− 1.363073




− 1.212799




− 1.33727




− 1.327154




− 1.380095




− 1.267421




− 1.314409




− 1.202882




− 1.424464




− 1.371182




− 1.221176




− 1.2365




− 1.305933




− 1.216461




− 1.45711




− 1.260881




− 1.263786




− 1.21274




− 1.285648




− 1.49097




− 1.554161




− 1.202909




− 1.281043




− 1.251836




− 1.207051




− 1.235688




− 1.273013




− 1.227973




− 1.260362




− 1.301554




− 1.467406




− 1.232606




− 1.407866




− 1.324321




− 1.245413




− 1.296558




− 1.429991




− 1.368897




− 1.269686




− 1.381513




− 1.20631




− 1.204469




− 1.245183




− 1.216418




− 1.212808




− 1.257121




− 1.2704




− 1.215692




− 1.224026




− 1.222362




− 1.275065




− 1.454294




− 1.202558




− 1.303624




− 1.278714




− 1.295586




− 1.273945




− 1.284986




− 1.258618




− 1.208955




− 1.257512




− 1.257421




− 1.300925




− 1.206028




− 1.237947




− 1.233673




− 1.207402




− 1.272287




− 1.207964




− 1.201634




− 1.212456




− 1.208538




− 1.3172




− 1.20639




− 1.204792




− 1.26979




− 1.26321




− 1.222055




− 1.318907




− 1.231172




− 1.292294




− 1.22141




− 1.255189




− 1.300943




− 1.426354




− 1.304516




− 1.235653




− 1.314851




− 1.355157




− 1.224146




− 1.330922




− 1.201118




− 1.280786




− 1.228546




− 1.265687




− 1.231632




− 1.255684




− 1.249546




− 1.316093




− 1.299476




− 1.286256




− 1.218511




− 1.311688




− 1.204881




− 1.200973




− 1.205007




− 1.271309




− 1.248461




− 1.255306




− 1.32063




− 1.256589




− 1.226406




− 1.204295




− 1.346526




− 1.200408




− 1.230654




− 1.273183




− 1.23626




− 1.328935




− 1.277803




− 1.247917




− 1.212246




− 1.236162




− 1.266448




− 1.263839




− 1.279838




− 1.253353




− 1.217268




− 1.297937




− 1.260177




− 1.266836




− 1.349501




− 1.284679




− 1.207368




− 1.402528




− 1.24214




− 1.33578




− 1.240359




− 1.295313




− 1.288083




− 1.290819




− 1.330779




− 1.242708




− 1.268582




− 1.440286




− 1.213828




− 1.207139




− 1.419211




− 1.279893




− 1.210747




− 1.200582




− 1.283458




− 1.216892




− 1.205464




− 1.269379




− 1.262508




− 1.233783




− 1.219812




− 1.221046




− 1.203049




− 1.214363




− 1.208419




− 1.270677




− 1.22743




− 1.280195




− 1.408884




− 1.239878




− 1.229904




− 1.267289




− 1.234478




− 1.322234




− 1.214475




− 1.45726




− 1.357034




− 1.203534




− 1.234383




− 1.238529




− 1.213074




− 1.20816




− 1.311244




− 1.224874




− 1.257884




− 1.230161




− 1.217834




− 1.206307




− 1.273984




− 1.214008




− 1.289651




− 1.21791




− 1.266678




− 1.265515




− 1.334389




− 1.231796




− 1.242271




− 1.26309




− 1.311043




− 1.2066




− 1.277558




− 1.322598




− 1.31133




− 1.290136




− 1.300583




− 1.336139




− 1.232074




− 1.25914




− 1.284554




− 1.331341




− 1.33558




− 1.266774




− 1.219982




− 1.208158




− 1.260407




− 1.24681




− 1.237969




− 1.246781




− 1.286913




− 1.200492




− 1.224284




− 1.215864




− 1.219674




− 1.262919




− 1.281658




− 1.319983




− 1.267284




− 1.230796




− 1.235907




− 1.204552




− 1.205138




− 1.265677




− 1.382737




− 1.229053




− 1.241303




− 1.291223




− 1.222683




− 1.310438




− 1.291211




− 1.226001




− 1.211515




− 1.203515




− 1.446996



Probe set ID

Fold change


Gene feature

(C) Genes up/down-regulated in non-purified lung TCsSV40 compared with non-purified primary lung TCs






− 2.581599








− 2.019509




− 2.001725












− 1.864365




− 1.77743




− 1.924593




− 3.110776




− 1.758147




− 1.730004




− 2.037057




− 1.823703




− 2.018038




− 1.938506




− 2.156997




− 2.013654




− 3.896927




− 1.982875




− 2.074788




− 1.697784




− 2.003858








− 1.582128




− 2.527727




− 1.937361




− 1.926476








− 1.806913




− 2.163126




− 1.436061




− 1.484801












− 1.503467








− 2.164873




− 1.587573




− 1.766618




− 1.73117




− 1.835321








− 1.643053




− 1.603866




− 1.766003








− 1.371777




− 1.829949




− 1.550803




− 1.592587




− 1.820415




− 1.524415




− 1.49041












− 2.303785




− 1.900128




− 2.893756




− 1.731076




− 1.729942




− 1.439815




− 1.581381




− 1.31385








− 1.542513




− 1.48484




− 1.863709




− 1.466269




− 1.596942




− 1.514826




− 1.937731




− 1.586137




− 1.693797




− 1.463012




− 1.80746




− 1.573292




− 2.24906




− 1.648953








− 1.764414




− 1.389758




− 1.4781




− 1.537491












− 1.509417




− 1.444487




− 1.577232




− 1.651639








− 1.666162




− 1.606681




− 1.472658




− 1.627176




− 1.408795




− 1.887078




− 1.467576




− 1.320789




− 2.065452








− 1.600614




− 1.56655




− 1.469338




− 1.926968




− 1.453724












− 1.562003




− 1.587704




− 1.575569




− 1.483066
















− 1.609154




− 1.559053












− 1.561394




− 1.474893




− 1.57355




− 1.518545








− 1.448062




− 1.493469




− 1.537085




− 1.566265




− 1.55349




− 1.350821




− 1.401198




− 1.616867




− 1.50443




− 1.809445




− 1.618734




− 1.618734








− 1.420416




− 1.551184




− 1.554678




− 1.494772












− 1.895656




− 1.513562




− 1.606915




− 1.453698




− 1.421703




− 1.391548




− 1.275207




− 1.443218
















− 1.347272




− 1.559985




− 1.465136




− 1.557631




− 1.266228




− 1.575772












− 1.512663




− 1.474029








− 1.591351




− 1.754444




− 1.575065




− 1.30884




− 1.291479




− 1.450031








− 1.459176




− 1.399173




− 1.277475








− 1.527189




− 1.492463




− 1.686158




− 1.440374




− 1.476748








− 1.716035


