Skip to content

Advertisement

  • Research
  • Open Access

Influence of gene modification in biological behaviors and responses of mouse lung telocytes to inflammation

Contributed equally
Journal of Translational Medicine201917:158

https://doi.org/10.1186/s12967-019-1870-y

  • Received: 1 March 2019
  • Accepted: 3 April 2019
  • Published:

Abstract

Background

Telocytes play key roles in maintenance of organ/tissue function and prevention of organ injury. However, there are great challenges to investigate telocytes functions using primary telocytes, due to the difficulties of isolation, identification, and stability. The present study aims at constructing continuous cell strain of mouse lung telocyte cell line with stable characters by gene modification and investigating biological behaviors and responses of gene-modified telocytes to inflammation.

Methods

Mouse primary lung telocytes were isolated and identified using immune-labeling markers and immunoelectron microscopy. Primary telocytes were transformed with Simian vacuolating virus 40 small and large T antigen (SV40). Biological characters, behaviors morphology, and proliferation of those gene-modified telocytes were defined and monitored dynamically for 50 generations, as compared with primary lung telocytes. Cell cycle of mouse primary lung telocytes or gene-modified telocytes was detected by flow cytometry.

Results

Gene modified telocytes of generations 5, 10, 30 and 50 were observed with telopodes and also showed CD34 and ckit positive. Multiple cellular morphology were also observed on telocyte cell-line under monitor of celliq and enhanced cell proliferation were showed. SV40 transduction was also reduced apoptosis and increased the ratio of S and G2 phases in telocyte cell-line.

Conclusion

We successfully constructed mouse lung telocyte cell-line which maintained the biological properties and behaviors as primary telocytes and could responses to inflammation induced by LPS. Thus, gene-modified lung telocytes, Telocyte Line, would provide a cell tool for researchers exploring the roles and applications of telocytes involved in physiological and pathological states in future.

Keywords

  • Telocytes
  • Gene modification
  • Lung
  • SV40
  • Transformation

Background

Telocytes (TCs) have been found widely spreaded in a large number of organs and tissues of mammals, including atrial and ventricular myocardium, bladder, lung skeletal muscle, gastrointestinal tract, eyes, and others. TCs communicate with neighboring cells by homo- and heterocellular contacts and transfer genetic information and signaling molecules to influence other cells [1, 2]. Shoshkes-Carme et al. [3] recently demonstrated that TCs can be the major source of Wnt signaling, and play dependent roles in proliferation of intestinal stem cells and epithelial renewal. This particular study provides solid evidence that forkhead box L1-positive TCs contribute to the formation of the subepithelial plexus of the intestine, support the entire epithelium, and provide niche signals to intestinal stem cells, by producing Wnt ligands and maintaining Wnt signal pathway. Although TCs are often allocated within the stem cell niche, pulmonary TCs have different genetic profiles and biological functions from stem cells, fibroblasts, alveolar type II cells, airway basal cells, proximal airway cells, and T cells from bronchial lymph nodes or from lungs, respectively [47]. TCs functionally and constructively support and connect tissue cells, function as signal massage carriers, and benefit gene and cell therapies [812].

Gene modification is considered as a potential therapy to genetically prevent and treat diseases, even though a large number of factors still need to furthermore clarified, e.g. safety, efficacy, and complexity. With rapid development of gene editing technology, the precision and efficacy of gene modification are improved significantly [13, 14]. Safety profiles of gene modification as part of limitations require more preclinical and clinical evidence. The present study investigates potential effects of gene modification on morphological phenomes, biological behaviors and functions, as well as responses to inflammation in lung TCs. An anti-aging gene from Simian vacuolating virus 40 was transferred as the target gene into primary TCs isolated from mouse lungs to improve the longevity of cells, since primary TCs hardly survive in the in vitro system for a few weeks or months [57].

Materials and methods

TCs isolation and primary cell culture

Mice were provided by Animal Facility in Biomedical Research Center of Zhongshan Hospital, Fudan University. This study was approved by the Fudan University Ethical Committee for animal experiments.

Mouse lung TCs were isolated and prepared as escribed previously [4]. In brief, female BABL/c mice aged 6–8 weeks were used and anaesthetized. The trachea and lung tissues were isolated and collected into sterile tubes, containing Dulbecco’s Modified Eagle’s Medium plus F12 (DMEM/F12) integration (Gibco, NY, USA), supplemented with 100 UI/ml penicillin, 0.1 mg/ml streptomycin (Sigma-Aldrich Shanghai Trading Co Ltd., Shanghai, China). Samples were placed on ice and transported to the cell culture laboratory within 30 min. The tissues were cut into about 1 × mm3 in sterile DMEM/F12 and incubated in 10 mg/ml collagenase type II (Sigma-Aldrich, St. Louis, MO, USA) and 2000 U/ml deoxyribonuclease I (Sigma-Aldrich) on an orbital shaker for 4 h, at 37 °C. Cell suspension was separated by 40-m-diameter cell strainer (BD Falcon, NJ, USA), and dispersed cells were collected by centrifugation. Cells were resuspended in DMEM/F12, supplemented with 10% fetal calf serum, 100 UI/ml penicillin, 0.1 mg/ml streptomycin (Sigma-Aldrich), and cultured in a incubator, with 5% CO2 in air, at 37 °C, for 30 min, to wipe off most fibroblasts. Cell suspension was transferred to other flakes and cultured for another 12 h before changing culture medium. Culture medium was changed every 48 h. Cells were examined by phase contrast microscope, under an inverted Olympus phase contrast microscope (1 × 51; Tokyo, Japan).

Lentivirus construction and infection

Lentivirus particles containing the small and large T antigen of anti-aging gene from Simian vacuolating virus 40 (SV40) gene were constructed (HanyinCo., Shanghai, China) according to the former articles [15]. The oligo (listed 5′–3′) SV40-F: CCG GAATTCATGGATAAAGTTTTAAACAGAGAGGAATC and SV40-R: GCTCTAGATTACAAGTCCTCTTCAGAAATGAG. TCs were infected on 6-well plates for 12 h at 37 °C, replaced fresh medium, and harvested for qPCR analysis to determine the SV40 mRNA expression level after being cultured for 96 h at 37 °C.

RNA extraction and PCR

Primary TCs and TCs transformed with SV40 (TCsSV40) were seeded in 24-well plates with a density of 104 cells/well and cultured for 24 h at 37 °C. Cells were washed thrice with PBS, and total RNA was isolated and transcribed into single-stranded cDNA using the 1st Strand cDNA Synthesis Kit for RT-PCR (AMV, Roche) following the recommendations of the manufacturer.

cDNA was synthesized from 1 µg of total RNA using PrimeScript® RT reagent Kit (Takara Bio Inc., Shiga, Japan). PCR was performed with 1 µl of cDNA using GoTaq polymerase (Promega) for 25 cycles with specific primers for SV40. PCR reaction products were resolved and stained with Gelred (Biotium Inc., Newark, USA).

Detection of cell bio-behaviors

The bio-behaviors of TCs and TCsSV40 were recorded and analyzed using a Cell-IQ cell culturing platform (Chip-Man Technologies, Tampere, Finland), equipped with a phase-contrast microscope (Nikon CFI Achromat phase contrast objective with 10 magnification) and a camera20. The bio-behaviors, including cell proliferation, division, death, cell morphology, and cell movement, can be monitored and recorded as time-lapse data by this Cell-IQ system uses machine vision technology. Images were captured at about 30 min intervals for 48 h. Analysis was carried out with a freely distributed Image software (McMaster Biophotonics Facility, Hamilton, ON), using the Manual Tracking plugin created by Fabrice Cordelie´res (Institute Curie, Orsay, France).

RNA microarrays and long non-coding RNA (lncRNA) classification pipeline

RNA microarrays and lncRNA classification pipeline were tested in primary TCs or TCsSV40. Briefly, total RNA was collected using NucleoSpin® RNA Plus according the manufacturer’s protocol (Macherey–Nagel, Inc., Düren, Germany). Microarray and quality controls of gene expression profiling were performed after RNA and cDNA amplifications, using the GeneChip® Human Transcriptome Array 2.0 gene chip (Affymetrix, Inc., UK) with 67,528 genes. Gene expression data from each group were analyzed using Expression Console and Transcriptome Analysis Console 3.0.0.466 (Affymetrix). The differentially expressed mRNA and lncRNAs were used for a hierarchical clustering analysis (HCA) in Cluster and TreeView (https://sourceforge.net/projects/jtreeview/files/).

Immunofluorescent staining

Double immunofluorescent staining for CD34 and vimentin was performed as previously reported [21]. In brief, primary TCs or TCsSV40 in 1, 5, 10, 30, or 50 generations were load and cultured on glass bottom cell culture dishes with 20 mm diameter glass (NEST, Nanjing, China) and were fixed in 4% paraformaldehyde containing 0.05% Triton-X-100 for 20 min. The cells were washed thrice with PBS and blocked in 5% bovine serum albumin (BSA) for 1 h and incubated overnight at 4 °C with mouse anti-CD34 antibody and goat anti-vimentin antibody or rabbit anti-ckit antibody (1:200 dilution; Abcam, Cambridge, UK) diluted in 1% BSA in PBS. Cells were washed in PBS thrice and incubated with PE conjugated anti-goat secondary antibodies and FITC conjugated anti-rabbit secondary antibodies and/or FITC conjugated anti-mouse secondary antibodies (1:200 dilution; Jackson ImmunoResearch, USA). The nuclear were marked by DAPI staining, according to the manufacture’s instruction (KeyGEN BioTECH, Nanjing, China).

Transmission electron microscopy

The ultrastructure of cells were observed under transmission electron microscopy (TEM) as previously reported (14). In brief, primary TCs or TCsSV40 in 1, 5, 10, 30, and 50 generations were cultured, collected, and fixed in 4% glutaraldehyde (pH 7.3, 4 °C) for 4 h. Cells were then washed with 0.1 M cacodylate buffer and post-fixed with 1% osmium tetroxide in 0.1 M cacodylate buffer (pH 7.3, 4 °C). After fixing, cells were dehydrated in a graded series of ethanol, impregnated in propylene oxide (immersed overnight in a mixture of propylene oxide and Epon 812 resin), and embedded in Epon 812. Ultrathin sections at 70 nm were cut on a Leica LKB-II (Nußloch, Germany), collected on Formvar-coated copper grids, stained with uranyl acetate and lead citrate, and observed at an acceleration voltage of 80 kV electron microscope (JEOL JEM-1230, Tokyo, Japan).

Immunoelectron microscopy

Ultrathin sections were prepared and collected on nickel grids. Immunolabeling staining for CD34/Vimentin and ckit/platelet-derived growth factor receptor α (PDGFR-α) was used as previously reported [22]. In brief, sections were incubated in 50 mM Glycine for 30 min and washed in Ultra-pure Water thrice for 5 min. Sections were etched in 1% sodium periodate for 10 min following washing in Ultra-pure water. Sections were incubated in the blocking buffer for 20 min and labeled with rabbit anti-ckit antibody, mouse anti-CD34 antibody, goat anti-vimentin antibody and/or rat anti PDGFR-α antibody (1:200 dilution; Abcam) at 4 °C for 24 h. The nickel grids were washed in PBS for 5 min 12 times, blocked within 1% BSA for 20 min, and incubated with 10 nm gold conjugated anti-goat secondary antibodies, 18 nm gold conjugated anti-mouse secondary antibodies, 25 nm gold conjugated anti-rat secondary antibodies, and/or 40 nm gold conjugated anti-rabbit secondary antibodies (1:200 dilution; Abcam) for 2 h. Nickel grids were dried on filter paper and observed with transmission electronic microscopy (TEM). The staining controls included cells stained only with the second antibodies with gold labelling or the first antibodies.

Cell cycle assay

Propidium iodide (PI) staining was used for cell cycle analysis of primary TCs and TCsSV40 as described in manufacturer. In brief, cells were collected and fixed in 75% ethanol at 4 °C for overnight. After centrifuging and washing, staining buffer (BD Pharmingen, NJ, USA) with 0.5 ml PI/RNase was added to each tube for 15 min at room temperature. Samples were examined with a fluorescence-activated cell sorting flow cytometer (FACS Aria II, Becton, Dickinson and Company, NJ, USA) and DNA histograms were analyzed with Flowjo 7.6.1 software. Each test was repeated thrice.

Statistics

Data were expressed as mean ± SEM analyzed using SPSS Statistics 20 (IBM, Chicago, USA). Statistical differences between two groups were compared by t-test. Statistical differences among more than two groups were determined using ANOVA. p value less than 0.05 was considered significant.

Results

Telopodes (Tps) as one of characteristic structures of TCs were demonstrated in Fig. 1a, b. The c-kit/CD117, CD34 and vimentin in primary lung TCs were detected and shown in Fig. 1c, d, f–h. TEM tomography also showed that TCs have narrow and flat cellular prolongations surrounding other TCs in Fig. 1i, j. Mitochondria and endoplasmic reticulums in cytoplasm and nuclear of TCs were shown (Fig. 1k). Cytomembrane were also shown clearly under TEM (Fig. 1l).
Fig. 1
Fig. 1

Characteristics of primary lung telocytes (TCs). a, b Telocytes with telopodes (black arrow heads), c positive staining of c-kit (green), and telopodes (white arrow heads), d positive staining CD34 (green), and telopodes (white arrow heads), e nuclear staining with DAPI, f positive staining of vimentin (red), g positive staining of CD34 (green), h merge of DAPI, vimentin, and CD34, i telopode ultrastructure (Tp), j organelle and cell membrane, k mitochondrial (black arrows), mitochondrial vacuoles (white arrow head) and endoplasmic reticulum (black arrow head) in the cytoplasm, and l microvilli under TEM

The quality of SV40 gene insert in TCsSV40 were defined with SV40 mRNA expression and shown in Fig. 2a. Characteristics of telocytes in TCsSV40 were identified and telopodes of TCsSV40 were observed and recorded in Fig. 2b. The positive staining of vimentin and CD34 was detected in primary lung TCs and TCsSV40, as presented in Fig. 2c, d.
Fig. 2
Fig. 2

TCs characteristics of lung TCs transferred with SV40 (TCsSV40). a SV40 mRNA expression of TCsSV40 cells, as compared with primary lung TCs or SV40-negative cells, b telopodes of TCsSV40 at 2 (b1), 5 (b2), 10 (b3), or 20 generations (b4), c positive staining of c-kit (green) in TCsSV40 at 2 (c1), 5 (c2), 10 (c3), or 20 generations (c4), d positive staining of CD34 (green) in TCsSV40 at 2 (d1), 5 (d2), 10 (d3), or 20 generations (d4), and e positive staining of CD34 (green) and vimentin (red) in TCsSV40 at 2 (e1), 5 (e2), 10 (e3), 20 (e4), 30 (e5), 40 (e6), 50 (e7), or 60 generations (e8), where cell nuclei were stained with DAPI

In order to demonstrated the immortalization and stability of TCsSV40, telopodes were observed in TCsSV40 cultured for 1, 5, 10 and 20 generations SV40 mRNA positively expressed in TCsSV40 cells through generations, as compared with primary lung TCs or SV40-negative cells (Fig. 2a). Characteristics of TCsSV40 were furthermore evaluated at 2, 5, 10, or 20 generations, respectively, including telopodes (Fig. 2b1–b4), positive staining of c-kit (Fig. 2c1–c4), positive staining of CD34 (Fig. 2d1–d4), or positive staining of both CD34 and vimentin at 2 (e1), 5 (e2), 10 (e3), 20 (e4), 30 (e5), 40 (e6), 50 (e7), or 60 generations (e8), where cell nuclei were stained with DAPI. Dynamic alterations of TCsSV40 at 2, 5, 10, 20, 30, 50, or 60 generations were recorded automatically each 30 min for 48 h and cell morphological phenomes were presented each 12 h, respectively, in Additional file 1: Figure S1. Figure 3 demonstrated that immuno-positive staining of the vimentin labeled with particle diameter at 10 nm, CD34 at18 nm, platelet-derived growth factor receptor α (PDGFRα) at 25 nm, or ckit at 40 nm in lung TCsSV40 under transmission electronic microscopy. Tomography of TCs was taken immediately after transfer with SV40 tomography, to show mitochondria-rich cytoplasm and surrounded nucleus as well as telopodes with mitochondria (Fig. 3a). PDGFRα, ckit, or vimentin and CD34 were easily detected in TCsSV40 at 2 (b, c, d), 5 (e, f), 10 (g, h), 30 (i, j), or 50 generations (k, l), respectively. Those findings of transmission electronic microscopy tomography expression demonstrated that the characteristic structures and expressions of specific markers could be stable and consistent until generation 60.
Fig. 3
Fig. 3

Immuno-staining transmission electronic microscopy tomography of vimentin, CD34, platelet-derived growth factor receptor α (PDGF), or ckit of lung TCs transferred with SV40 (TCsSV40). a TCsSV40 tomography, and positive staining of vimentin ( , 10 nm), CD34 ( , 18 nm), PDGF ( , 25 nm), or ckit ( , 40 nm) in TCsSV40 at 2 (bd), 5 (e, f), 10 (g, h), 30 (i, j), or 50 generations (k, l)

The profiles of transcriptional factor and lncRNA genes between primary lung TCs and TCsSV40 were compared and listed in Tables 1 and 2, and the hotmap was shown in Fig. 4. As compared with purified primary lung TCs, 367 or 621 genes were up- or down-regulated in purified TCsSV40, 668 or 890 genes in non-purified lung TCsSV40, or 36 genes up-regulated in non-purified primary lung TCs. As compared with non-purified TCsSV40, 71 or 116 genes were up- or down-regulated in purified TCsSV40. Details of transcriptional factor and lncRNA gene profiles were listed in Additional file 2: Table S1. COL3A1 and SFRP2, which code alpha 1 type III collagen and secreted frizzled-related protein 2, respectively, significantly up-regulated in purified TCsSV40, as compared with purified primary lung TCs. The patterns of transcriptional factor and lncRNA gene profiles were shown in Fig. 4a, b, respectively). The top 5 transcriptional factor genes are COL3A1, SLIT3, FST, NNAT and PCDH17, respectively. The top 5 lncRNA genes are TC17000728.hg.1, TC06001978.hg.1, TC08000302.hg.1, TC07001784.hg.1 and TC03003114.hg.1, respectively.
Table 1

Summary of mRNA expressed preferentially in primary TCs, SV40-transformed TCs, primary lung cells, and SV40-transformed primary lung cells

Compared pairs

Up > 0

Up > 2

Down > 0

Down > 2

Purified TCsSV40 vs. non-purified primary lung TCs

158

0

124

0

Non-purified lung TCsSV40 vs. purified primary lung TCs

343

1

119

0

Non-purified lung TCsSV40 vs. non-purified primary lung TCs

274

1

151

0

Purified TCsSV40 vs. non-purified lung TCsSV40

64

0

75

0

Purified TCsSV40 vs. purified primary lung TCs

255

2

122

0

Purified primary lung TCs vs. non-purified primary lung TCs

0

0

23

0

Gene symbol or probe set ID

Fold change

p-value

Gene feature

(A) Genes up/down-regulated in purified TCsSV40 compared with non-purified primary lung TCs

COL3A1

1.736972

5.20E−05

Up

SLIT3

1.428832

5.70E−05

Up

FST

1.757618

6.20E−05

Up

NNAT

1.428018

6.60E−05

Up

PCDH17

−  1.82768

7.10E−05

Down

KIAA1199

1.450952

7.60E−05

Up

BHLHE22

1.431489

8.10E−05

Up

KLHDC10

− 1.342675

8.60E−05

Down

CAPN6

− 1.502786

9.10E−05

Down

DBC1

1.42647

9.60E−05

Up

ANGPTL7

1.490275

0.000101

Up

FBN1

1.555173

0.000106

Up

IGFBP7

1.491186

0.000111

Up

COL5A2

1.521795

0.000116

Up

SPRR1B

− 1.653323

0.000121

Down

PCDH7

1.645697

0.000126

Up

MBD6

− 1.354523

0.000131

Down

PPARGC1A

− 1.46284

0.000135

Down

SFRP2

1.953208

0.00014

Up

UPRT

− 1.391618

0.000145

Down

BNC1

1.309024

0.00015

Up

TNC

1.396486

0.000155

Up

EGR1

− 1.562517

0.00016

Down

COL12A1

1.253525

0.000165

Up

ZFP36L1

1.413153

0.00017

Up

NFAT5

− 1.658072

0.000175

Down

GFPT2

1.261057

0.00018

Up

FOXP2

1.209035

0.000185

Up

TCF20

− 1.334035

0.00019

Down

STAT3

1.388462

0.000195

Up

GATA6

1.445955

0.000199

Up

CYP51A1

1.224699

0.000204

Up

IGF1

1.320664

0.000209

Up

COL1A1

1.467933

0.000214

Up

PCDH19

− 1.536647

0.000219

Down

VLDLR

− 1.263978

0.000224

Down

HOXA2

1.693458

0.000229

Up

OGT

− 1.620988

0.000234

Down

ANKH

− 1.252673

0.000239

Down

ZNF503

1.323818

0.000244

Up

PCDH10

1.55352

0.000249

Up

HIF1A

1.439987

0.000254

Up

TGFB1I1

1.228978

0.000259

Up

MED12

− 1.302994

0.000264

Down

FBLN2

1.27815

0.000268

Up

HMGCS1

1.267852

0.000273

Up

CPXM1

1.343796

0.000278

Up

ILDR2

1.398758

0.000283

Up

MID2

− 1.297559

0.000288

Down

SEMA3A

− 1.339824

0.000293

Down

PTGS2

− 1.251508

0.000298

Down

BICC1

1.416447

0.000303

Up

KMT2D

− 1.222378

0.000318

Down

NFIA

1.44573

0.000323

Up

SMO

− 1.262105

0.000328

Down

TMEM238

1.23793

0.000332

Up

DNAJC1

1.241613

0.000337

Up

H2AFY2

1.200548

0.000342

Up

ARF6

1.267706

0.000347

Up

ACLY

1.32049

0.000352

Up

SPRR2F

− 1.383183

0.000357

Down

SCD

1.264224

0.000362

Up

GPC4

− 1.211023

0.000367

Down

KLF9

1.351626

0.000372

Up

ITPR3

− 1.227564

0.000377

Down

CDH11

1.285389

0.000382

Up

NXN

1.291856

0.000392

Up

MMP2

1.261064

0.000397

Up

GPM6B

1.298864

0.000401

Up

GRIA3

1.443882

0.000406

Up

CCND2

− 1.243142

0.000411

Down

LOX

1.244763

0.000416

Up

MSI2

− 1.254073

0.000421

Down

FAM126A

− 1.296542

0.000426

Down

TC11000974.hg.1

− 1.348845

0.000431

Down

DOCK9

− 1.213445

0.000446

Down

TRBV21OR9-2

− 1.381268

0.000451

Down

THBS1

1.376867

0.000456

Up

PLK1

1.251123

0.000461

Up

DDX26B

− 1.339568

0.000465

Down

FRMD5

1.270501

0.00047

Up

ADAMTS15

1.347894

0.000475

Up

MBNL1

− 1.406503

0.00048

Down

AZIN1

− 1.31031

0.000485

Down

WT1

1.203106

0.00049

Up

COL1A2

1.333456

5.00E−04

Up

ISM1

1.372788

0.000505

Up

PRRX1

1.396349

0.00051

Up

IGIP

− 1.26922

0.000515

Down

TSHZ1

1.31218

0.00052

Up

TNPO3

− 1.26636

0.000525

Down

FAM98A

1.240276

0.00053

Up

HSPA5

1.505916

0.000534

Up

PRG4

1.279794

0.000539

Up

UGCG

1.205908

0.000554

Up

CDKL5

− 1.282448

0.000559

Down

HOXB8

1.214483

0.000564

Up

RDH10

1.230479

0.000569

Up

ARL6IP1

1.267388

0.000574

Up

RNF150

1.296804

0.000594

Up

TBPL1

− 1.345451

0.000598

Down

KLF7

1.240203

0.000603

Up

ID4

1.227502

0.000608

Up

MBTPS2

− 1.372487

0.000618

Down

AHCYL2

− 1.2362

0.000623

Down

C9orf172

1.232029

0.000628

Up

THBS2

1.234081

0.000633

Up

IER5L

1.31756

0.000638

Up

FZD8

1.478565

0.000643

Up

REXO2

1.287723

0.000658

Up

MAN1A1

1.214421

0.000663

Up

PLXDC2

1.315137

0.000677

Up

DPYSL2

1.20111

0.000682

Up

INTS5

1.320636

0.000687

Up

ABCB7

− 1.288423

0.000692

Down

C3orf58

1.21307

0.000712

Up

FAM218A

1.35927

0.000717

Up

FMR1

1.401071

0.000722

Up

PCDHGC5

1.328006

0.000731

Up

TRPS1

− 1.275263

0.000736

Down

GPC6

1.24421

0.000741

Up

TC07000141.hg.1

− 1.446989

0.000771

Down

SEC23A

1.295262

0.000776

Up

ZDHHC15

− 1.240478

0.000786

Down

SMAD7

1.261408

0.000791

Up

GPC3

1.218435

0.000796

Up

TUBB4B

1.245339

0.00081

Up

TXNIP

1.202009

0.00082

Up

FIGN

1.385827

0.000825

Up

TC02002617.hg.1

− 1.775002

0.00084

Down

DTNA

− 1.217215

0.00085

Down

MEIS1

1.369642

0.000855

Up

PLK2

− 1.202425

0.00086

Down

RBPJ

− 1.218305

0.000864

Down

NPR2

− 1.309717

0.000869

Down

NID1

1.228805

0.000874

Up

AKT3

− 1.201507

0.000879

Down

SAT1

− 1.219609

0.000884

Down

SURF4

1.201325

0.000889

Up

CELF2

1.384512

0.000914

Up

ZBTB18

− 1.426169

0.000933

Down

TOX

1.381994

0.000938

Up

DACT1

1.205543

0.000943

Up

CASK

− 1.472338

0.000958

Down

KITLG

1.267156

0.000963

Up

KMT2A

− 1.28931

0.000968

Down

TRBV6-8

− 1.402432

0.000973

Down

PARP6

− 1.228703

0.000983

Down

CLMP

1.252655

0.001007

Up

EGR3

− 1.348087

0.001017

Down

PCDHB1

− 1.305233

0.001022

Down

TC10000913.hg.1

− 1.441636

0.001037

Down

TC01001567.hg.1

− 1.297173

0.001066

Down

SLC16A2

1.240464

0.001081

Up

COLEC12

1.203956

0.001096

Up

PAPD5

− 1.251764

0.001101

Down

GABRA3

1.355514

0.001116

Up

LPCAT3

1.334572

0.001126

Up

FAM102B

− 1.249464

0.00113

Down

CALR

1.210971

0.00115

Up

CNTFR

1.207485

0.00116

Up

HUWE1

− 1.286372

0.001165

Down

LOXL1

1.3066

0.00117

Up

JHDM1D

− 1.223213

0.00119

Down

HPRT1

− 1.395397

0.001209

Down

HOXC8

1.24955

0.001214

Up

DOCK11

− 1.266513

0.001234

Down

R3HDM2

− 1.226605

0.001278

Down

TRAM1L1

1.237032

0.001283

Up

POLA1

− 1.316949

0.001288

Down

VPS35

− 1.217861

0.001298

Down

CALU

− 1.289373

0.001323

Down

CD248

1.327827

0.001347

Up

THOC2

− 1.388434

0.001377

Down

UCP2

1.214025

0.001387

Up

ETV6

1.275435

0.001396

Up

AP2S1

1.218648

0.001411

Up

PIAS1

− 1.266045

0.001475

Down

TFAP2A

− 1.207326

0.00149

Down

IGFBP4

1.208644

0.0015

Up

DDIT3

− 1.300464

0.001515

Down

PRR9

− 1.306757

0.001529

Down

LRP1

1.262418

0.001539

Up

EPHA7

1.222492

0.001549

Up

GATM

1.233004

0.001594

Up

MSN

− 1.260531

0.001598

Down

P4HA3

1.253025

0.001623

Up

TAF10

1.23132

0.001628

Up

PDE7B

1.265724

0.001643

Up

KLHL13

1.21332

0.001658

Up

ATP11C

− 1.236782

0.001746

Down

HIST1H4L

1.225746

0.001761

Up

JMJD1C

− 1.223153

0.001766

Down

WNK1

− 1.347429

0.001791

Down

ATP6AP2

− 1.265769

0.001815

Down

TRBV10-1

− 1.203962

0.001855

Down

SRPX

1.225977

0.001864

Up

FGF7

1.217304

0.001909

Up

TMTC2

1.228712

0.001914

Up

MYO1D

1.22793

0.001948

Up

SARS

− 1.329997

0.001968

Down

STRBP

− 1.209603

0.002002

Down

SOX4

1.201564

0.002017

Up

EGR2

− 1.203287

0.002022

Down

LCE1D

− 1.216676

0.002047

Down

MED14

− 1.219439

0.002076

Down

OR10P1

− 1.236803

0.002086

Down

EXT1

1.244359

0.002091

Up

SOCS3

1.34295

0.002101

Up

CPSF6

− 1.214996

0.00216

Down

PKM

1.208686

0.00218

Up

FOSB

− 1.203628

0.002293

Down

TRAPPC1

1.301019

0.002318

Up

SPRR2B

− 1.274955

0.002323

Down

EMX2

1.278187

0.002396

Up

TOP1

1.225449

0.002401

Up

TBC1D19

− 1.224248

0.002406

Down

PTCHD1

− 1.206554

0.002431

Down

CDH2

1.221089

0.002441

Up

SPTLC2

1.254554

0.00252

Up

PCBP2

− 1.289738

0.002534

Down

IGKV1D-8

− 1.227643

0.002549

Down

TC03000927.hg.1

− 1.274058

0.002569

Down

TC13000014.hg.1

− 1.205937

0.002633

Down

BRAF

− 1.234126

0.002648

Down

CNOT6L

− 1.272615

0.002658

Down

PAN3

− 1.295252

0.002707

Down

SETBP1

1.224547

0.002712

Up

SPRR1A

− 1.236736

0.002717

Down

TXLNG

− 1.205245

0.002726

Down

TSC22D2

− 1.307114

0.002761

Down

ATF3

− 1.205287

0.002776

Down

FUBP1

− 1.224805

0.002781

Down

DNAJC30

1.22357

0.002825

Up

RCN3

1.218967

0.002879

Up

AGFG1

1.246198

0.002884

Up

HNRNPA3

1.23159

0.002919

Up

SRPK2

− 1.200287

0.002943

Down

ATRX

− 1.226812

0.002978

Down

ADAMTS6

− 1.248056

0.002983

Down

RAB1A

1.34731

0.003022

Up

IGKV3− 11

− 1.238746

0.003121

Down

OR4C6

1.227941

0.003145

Up

XBP1

1.202697

0.00316

Up

MURC

− 1.350099

0.003189

Down

SNX12

− 1.22367

0.003209

Down

TC11000975.hg.1

− 1.332179

0.003239

Down

HOXA5

1.302985

0.003268

Up

RBP1

1.216422

0.003396

Up

TC19000375.hg.1

− 1.216419

0.003406

Down

KDM6A

− 1.327135

0.003505

Down

TC06001136.hg.1

− 1.438272

0.003628

Down

CAV1

− 1.206156

0.003643

Down

ACSL4

1.257627

0.003682

Up

LRP6

1.211757

0.00379

Up

HIST1H1B

1.245633

0.004096

Up

DEFB136

− 1.244558

0.00415

Down

FBXO33

1.239768

0.004229

Up

TANC2

− 1.233366

0.004303

Down

USP12

1.334372

0.004475

Up

OR5A2

− 1.287342

0.004539

Down

TC18000270.hg.1

1.23255

0.004657

Up

OR51L1

− 1.224446

0.004948

Down

OR51B6

− 1.256007

0.004992

Down

PTEN

1.249442

0.005116

Up

TMSB10

1.251421

0.005327

Up

VEZF1

− 1.29591

0.005436

Down

NFIB

1.220599

0.0055

Up

CCDC166

1.217336

0.005529

Up

STAG2

− 1.224684

0.005933

Down

PIAS2

− 1.200256

0.00648

Down

ZSWIM6

1.222542

0.00651

Up

ZNF281

1.209366

0.006697

Up

SYT11

1.201281

0.00682

Up

SCXA

− 1.222753

0.007815

Down

ALX1

− 1.230342

0.007992

Down

EFNA5

1.202225

0.008702

Up

MGC15705

1.234392

0.009229

Up

GPR174

1.246926

0.009317

Up

TC09000877.hg.1

− 1.325127

0.010825

Down

KRTAP19-4

1.262139

0.010972

Up

OR52N2

1.201364

0.011977

Up

Gene symbol

Fold change

p-value

Gene feature

(B) Genes up/down-regulated in non-purified lung TCsSV40 compared with purified primary lung TCs

COL1A1

2.030789

5.20E−05

Up

COL1A2

1.647326

5.70E−05

Up

SYVN1

1.520112

6.20E−05

Up

COL12A1

1.390303

6.60E−05

Up

MYH10

1.517922

7.10E−05

Up

ACTA1

1.453697

7.60E−05

Up

SLIT3

1.501818

8.10E−05

Up

COL3A1

1.756169

8.60E−05

Up

FBN1

1.641521

9.10E−05

Up

COL5A2

1.737694

9.60E−05

Up

GATA6

1.796826

0.000101

Up

IGFBP7

1.641817

0.000106

Up

SEMA3D

1.437537

0.000111

Up

ANGPTL7

1.811625

0.000116

Up

MEIS2

1.53255

0.000121

Up

THBS1

1.678925

0.000125

Up

HS6ST2

1.220779

0.00013

Up

BICC1

1.50068

0.000135

Up

MED12

− 1.428542

0.00014

Down

HSPA5

1.887927

0.000145

Up

PFN1

1.558653

0.00015

Up

PPARGC1A

− 1.432059

0.000155

Down

NFIB

1.535713

0.00016

Up

RBPJ

− 1.376913

0.000165

Down

ACTN1

1.37672

0.00017

Up

EXT1

1.57285

0.000175

Up

TNC

1.293769

0.00018

Up

PCDH7

1.762644

0.000185

Up

TXNIP

1.299338

0.000189

Up

LPCAT3

1.43629

0.000194

Up

COL4A5

1.312681

0.000199

Up

NUAK1

1.412387

0.000204

Up

ATP1A1

1.303558

0.000209

Up

WT1

1.363849

0.000214

Up

MASP1

− 1.206501

0.000219

Down

VCL

1.617321

0.000224

Up

IER5L

1.262549

0.000229

Up

MYO1D

1.463161

0.000234

Up

PLOD2

1.269697

0.000239

Up

FOXP2

1.290662

0.000244

Up

ATP1B1

1.344335

0.000248

Up

KRTAP29-1

− 1.332419

0.000253

Down

ITGAV

1.294132

0.000258

Up

CPXM1

1.343008

0.000263

Up

FST

1.55845

0.000268

Up

CTGF

1.578183

0.000273

Up

HMGCS1

1.228293

0.000278

Up

PLXDC2

1.295572

0.000288

Up

LOXL1

1.332093

0.000293

Up

TM9SF4

1.351928

0.000298

Up

GGCX

1.265383

0.000303

Up

INPPL1

1.32131

0.000308

Up

DUSP6

1.275474

0.000312

Up

NFIA

1.675759

0.000317

Up

GRIA3

1.592221

0.000322

Up

LTBP1

− 1.275386

0.000332

Down

BNC1

1.391268

0.000337

Up

FEZ1

− 1.275203

0.000342

Down

OGT

− 1.599369

0.000347

Down

NXN

1.203178

0.000352

Up

HIST1H2BM

1.309386

0.000357

Up

APH1A

1.273537

0.000362

Up

TMEM259

1.230715

0.000371

Up

THBS2

1.232906

0.000376

Up

ANXA6

1.256028

0.000381

Up

CDH2

1.2585

0.000391

Up

SEC23A

1.343492

0.000401

Up

NNAT

1.433848

0.000406

Up

EMX2

1.295739

0.000411

Up

VCAM1

1.215258

0.000416

Up

DNAJC1

1.413451

0.000421

Up

PCDH19

− 1.490493

0.000426

Down

ILDR2

1.412592

0.000431

Up

DOCK3

− 1.218811

0.000445

Down

DEFB128

− 1.253647

0.00045

Down

ERO1L

1.201323

0.00046

Up

CRYBA1

− 1.209259

0.000465

Down

CELF2

1.399193

0.000475

Up

ZNF503

1.316826

0.00048

Up

TM9SF3

1.337447

0.000485

Up

PTPRD

1.337777

0.000494

Up

IGHV3-43

− 1.352419

0.000499

Down

KIAA1199

1.358808

0.000509

Up

NPR2

− 1.233749

0.000514

Down

SLC7A2

1.219152

0.000519

Up

TRBV21OR9-2

− 1.26885

0.000524

Down

TCF7L2

1.344321

0.000534

Up

SRPX

1.275048

0.000549

Up

TUBG1

1.240509

0.000554

Up

TNFAIP1

1.207721

0.000558

Up

KCNAB1

1.21542

0.000563

Up

ARF6

1.224098

0.000568

Up

FBXO33

1.218704

0.000573

Up

PRPF19

1.25947

0.000578

Up

RAPH1

1.350071

0.000583

Up

PDIA3

1.527168

0.000593

Up

PBX3

1.328363

0.000598

Up

SEC23B

1.264846

0.000603

Up

GABRA3

1.405001

0.000608

Up

ARHGAP1

1.548495

0.000617

Up

AP3S1

1.293716

0.000622

Up

NFIX

1.300317

0.000627

Up

SPTLC2

1.34066

0.000632

Up

HOXC6

1.280515

0.000637

Up

RAB11B

1.318414

0.000642

Up

FHL1

1.206581

0.000652

Up

LMO4

1.222458

0.000672

Up

GBF1

1.291975

0.000677

Up

MBD6

− 1.274947

0.000681

Down

STAT3

1.346345

0.000686

Up

TLN1

1.318005

0.000691

Up

KIDINS220

1.20164

0.000696

Up

ETV6

1.300092

0.000701

Up

ATP2A2

1.245839

0.000706

Up

PARVA

1.340702

0.000711

Up

OR10D3

− 1.379974

0.000716

Down

ILK

1.411794

0.000721

Up

PLCE1

1.207815

0.000731

Up

SERPINH1

1.307929

0.000741

Up

HIF1A

1.377218

0.000745

Up

PDIA4

1.235338

0.000755

Up

MAP4K4

1.281043

0.00076

Up

REXO2

1.383088

0.000765

Up

SLC6A17

− 1.217838

0.00077

Down

PCDH17

− 1.632353

0.000775

Down

EFNA5

1.543491

0.00078

Up

LCE3E

− 1.318245

0.000785

Down

LOX

1.263793

0.00079

Up

FERMT2

1.235564

0.000795

Up

NEO1

1.379359

8.00E-04

Up

TENM3

1.236228

0.000819

Up

CDH11

1.294755

0.000824

Up

KLHDC3

1.275726

0.000829

Up

HMGA1

−  1.21677

0.000834

Down

SCD

1.277895

0.000839

Up

CCND2

− 1.222991

0.000844

Down

HES1

1.308538

0.000849

Up

PDE7B

1.38073

0.000854

Up

SPARC

1.349498

0.000864

Up

SMAD6

1.280817

0.000878

Up

SARS

− 1.260078

0.000883

Down

OSBP

1.345413

0.000903

Up

ACTR1A

1.256685

0.000913

Up

RUNX1T1

− 1.252339

0.000918

Down

TFAP2A

− 1.255715

0.000927

Down

NRG1

1.200557

0.000937

Up

HOXB5

− 1.295109

0.000942

Down

HECTD1

1.351927

0.000947

Up

LCE1C

− 1.270503

0.000952

Down

SPRED1

1.241191

0.000957

Up

PLAG1

− 1.268008

0.000967

Down

EFNB2

1.525576

0.000972

Up

HIPK3

1.37177

0.000977

Up

ID1

1.349752

0.000982

Up

GRIA4

1.321472

0.000991

Up

FAM168A

1.339626

0.001001

Up

FAM98A

1.331744

0.001006

Up

DERL2

1.375325

0.001026

Up

HSPA4

1.279904

0.001031

Up

ABCA1

1.213015

0.001036

Up

GATM

1.418597

0.001041

Up

SLC7A11

1.218849

0.001046

Up

RAB6A

1.254262

0.00105

Up

IGF1

1.369249

0.00107

Up

CCDC80

1.219878

0.00108

Up

KMT2D

− 1.206701

0.001085

Down

HOXC4

1.445692

0.00109

Up

PPP3CA

1.37054

0.001095

Up

HSPA1A

1.212978

0.0011

Up

BMPR2

1.217688

0.001105

Up

ACTG1

1.229217

0.00111

Up

ZDHHC5

1.288505

0.001114

Up

CNIH

1.285039

0.001124

Up

UNC5B

1.204984

0.001139

Up

CAPN6

− 1.418505

0.001149

Down

ZFP36L1

1.284405

0.001154

Up

FGF18

1.238166

0.001159

Up

RAB1A

1.541258

0.001164

Up

FMR1

1.333774

0.001208

Up

FAM188A

1.405263

0.001213

Up

FAM168B

1.275522

0.001228

Up

ITGB5

1.204294

0.001242

Up

KRTAP5-2

− 1.219252

0.001252

Down

FBLN5

1.287407

0.001262

Up

ACVR2A

1.403689

0.001277

Up

ADAMTS9

1.226553

0.001292

Up

NETO1

1.219365

0.001301

Up

ABI1

1.232061

0.001306

Up

INSL6

1.241028

0.001321

Up

TJP1

1.229587

0.001326

Up

HNRNPUL2

1.282031

0.001331

Up

COPG1

1.228987

0.001346

Up

COPB1

1.259033

0.001351

Up

DIO3

1.28299

0.001356

Up

DYNLL2

1.311492

0.00136

Up

DDX26B

− 1.257624

0.001365

Down

SLIT2

1.236976

0.00138

Up

GPC3

1.242766

0.001385

Up

PYGB

1.210405

0.001395

Up

MSANTD2

− 1.247787

0.001405

Down

CYGB

1.321169

0.00141

Up

GPC6

1.254278

0.001415

Up

TC08000204.hg.1

− 1.443858

0.001424

Down

STK39

1.37139

0.001429

Up

RAB1B

1.242841

0.001439

Up

ELAVL2

− 1.223928

0.001449

Down

HSP90B1

1.375708

0.001474

Up

ACTN4

1.314084

0.001483

Up

HSPA1A

1.215746

0.001503

Up

AMMECR1L

1.245785

0.001508

Up

RND3

1.239337

0.001518

Up

SPRY2

1.233483

0.001523

Up

DPYSL2

1.236003

0.001528

Up

DDB1

1.27575

0.001552

Up

SMARCA2

1.262741

0.001567

Up

HDGFRP3

1.330639

0.001572

Up

SULF1

1.221198

0.001577

Up

STK19

− 1.210825

0.001594

Down

STK19

− 1.210825

0.001594

Down

UPF2

1.267351

0.001606

Up

TRBV4-1

− 1.237852

0.001621

Down

APP

1.206738

0.001636

Up

AFF4

1.209778

0.001641

Up

MEF2A

1.213845

0.001651

Up

EDEM3

1.261632

0.001661

Up

HSPA1A

1.214617

0.001666

Up

GABRA4

1.24602

0.001675

Up

SPTAN1

1.260395

0.001685

Up

TEAD1

1.355621

0.001695

Up

WNK1

− 1.539904

0.001705

Down

LRP6

1.290518

0.00171

Up

PRRX1

1.233827

0.001749

Up

HSPA1A

1.213076

0.001759

Up

RAB8A

1.200712

0.001769

Up

STIM1

1.32461

0.001779

Up

ERLEC1

1.216094

0.001793

Up

ADRB1

1.24843

0.001803

Up

TMSB10

1.475064

0.001808

Up

ALCAM

1.207847

0.001857

Up

CYP51A1

1.220803

0.001862

Up

EGR3

− 1.357705

0.001877

Down

CDC27

1.318143

0.001887

Up

PANK3

1.23265

0.001921

Up

HOXA2

1.488536

0.001951

Up

TRBV6-8

− 1.340511

0.001971

Down

CRIM1

1.207809

0.001975

Up

LMAN1

1.205915

0.00198

Up

DEFB113

− 1.249904

0.001985

Down

FN1

1.284284

0.00199

Up

PRKG1

1.239048

0.00202

Up

TC15001075.hg.1

− 1.244805

0.002025

Down

HIST1H2BJ

1.336659

0.002074

Up

TMEM57

1.269164

0.002094

Up

USP12

1.314548

0.002118

Up

CAMK2N2

1.20406

0.002143

Up

TMTC2

1.200876

0.002162

Up

ANAPC1

1.257636

0.002167

Up

C1QL3

1.224547

0.002236

Up

KPRP

− 1.284699

0.002246

Down

PAPOLA

1.313258

0.002295

Up

ACTC1

1.2396

0.002305

Up

LCE2A

− 1.308229

0.00232

Down

CHD4

1.255055

0.002349

Up

EIF5

1.234533

0.002354

Up

PCDH10

1.328826

0.002379

Up

MYL9

1.277676

0.002404

Up

MUT

− 1.247925

0.002413

Down

MEIS1

1.223628

0.002423

Up

P2RX3

− 1.225147

0.002438

Down

UBE2M

1.345125

0.002458

Up

BMPR1A

1.384032

0.002482

Up

RAB39B

− 1.28009

0.002507

Down

MBNL2

1.267238

0.002556

Up

PLK1

1.222337

0.002561

Up

TRGV8

− 1.279773

0.002586

Down

CNN1

1.208197

0.00261

Up

ZSWIM6

1.291355

0.00265

Up

EFNB1

1.235229

0.002679

Up

MAN1A1

1.233248

0.002694

Up

HOXC8

1.264716

0.002714

Up

SMAD7

1.275196

0.002763

Up

TRIP12

1.322101

0.002778

Up

ATP2B1

1.212402

0.002812

Up

MEX3C

1.246507

0.002822

Up

SEC24A

1.225516

0.002827

Up

PSMC4

1.238673

0.002837

Up

KRTAP22-2

− 1.253194

0.002846

Down

LOC100509638

− 1.331709

0.002861

Down

KDM2A

1.21736

0.00292

Up

EIF4G2

1.346528

0.002945

Up

NOXRED1

− 1.247281

0.002964

Down

TC02002617.hg.1

− 1.384833

0.002989

Down

STT3A

1.269875

0.003009

Up

TC11000975.hg.1

− 1.273558

0.003058

Down

APOBEC1

− 1.247386

0.003063

Down

PPP2R5E

1.279695

0.003078

Up

FZD8

1.347838

0.003147

Up

HIST1H2BH

1.399643

0.003176

Up

AP1G1

1.251832

0.003191

Up

C11orf73

1.210719

0.003215

Up

RTN3

1.21898

0.00323

Up

LCE1E

− 1.222095

0.003255

Down

ADAM9

1.210498

0.00326

Up

CLINT1

1.294737

0.003294

Up

TRGV3

− 1.208645

0.003329

Down

P4HA3

1.227186

0.003388

Up

CELF1

1.215676

0.003417

Up

MAP4K5

1.258241

0.003422

Up

TARDBP

− 1.229146

0.003486

Down

BMP4

1.239271

0.003511

Up

ACTA2

1.255606

0.003525

Up

SF3B3

1.20972

0.003614

Up

DCUN1D5

1.248267

0.003634

Up

OLFML2B

1.220926

0.003643

Up

TOP1

1.254134

0.003663

Up

BTG1

− 1.348061

0.003673

Down

CALR

1.300821

0.003703

Up

H3F3A

1.228003

0.003742

Up

PUM1

1.232872

0.00383

Up

PSMA3

1.227334

0.003845

Up

OR2H2

− 1.261057

0.003865

Down

FAR1

1.284889

0.003875

Up

RC3H2

1.209665

0.003894

Up

IGKV1D-37

1.290533

0.003899

Up

EIF4B

− 1.253518

0.003949

Down

ROMO1

1.212986

0.004017

Up

NCKAP1

1.279797

0.004067

Up

HSPA2

1.241027

0.004086

Up

CPD

1.254726

0.004091

Up

NPR3

1.205107

0.004131

Up

RAP1B

1.300105

0.004165

Up

SEC62

1.322724

0.00419

Up

IGLJ4

1.46599

0.004263

Up

OR5A2

− 1.612969

0.004332

Down

IGLV6-57

1.202727

0.004342

Up

RAB21

1.224355

0.004367

Up

MMP14

1.259391

0.004465

Up

LELP1

− 1.280949

0.004475

Down

ZNF281

1.341512

0.004495

Up

KRTAP12-3

− 1.222558

0.004657

Down

MMD

1.36424

0.004691

Up

TIMP3

1.219996

0.004711

Up

ACTL8

− 1.248052

0.004746

Down

HIST1H2BE

1.383938

0.004829

Up

POLA1

− 1.226576

0.004839

Down

AIDA

1.221832

0.004854

Up

OR2H2

− 1.251288

0.004859

Down

PMP22

1.201201

0.004923

Up

KRTAP12-3

− 1.215537

0.004938

Down

SLC36A4

1.206965

0.004962

Up

SHOC2

1.224107

0.004972

Up

SOX4

1.200056

0.004977

Up

ISM1

1.253651

0.005031

Up

CSRP2

1.210735

0.005041

Up

OR4D11

− 1.307921

0.005046

Down

CAPRIN1

1.203686

0.005095

Up

PPP3R1

1.237317

0.005208

Up

PPIC

1.224048

0.005238

Up

PRAMEF10

− 1.247763

0.005257

Down

MBTPS2

− 1.210053

0.00542

Down

UBTD2

1.203269

0.00543

Up

SEC11A

1.208371

0.005449

Up

USP25

1.213603

0.005498

Up

PTMA

1.217797

0.005513

Up

FKBP1C

1.209098

0.005523

Up

ANKIB1

1.23614

0.005651

Up

GSPT1

1.233347

0.005715

Up

UCP2

1.209526

0.005735

Up

TGFB3

1.220573

0.005769

Up

HIST1H4G

1.221559

0.005803

Up

IGLJ5

− 1.226509

0.005818

Down

KIF5B

1.306336

0.005897

Up

TC10000913.hg.1

− 1.233065

0.006202

Down

TC03000927.hg.1

− 1.285309

0.006207

Down

PGRMC1

1.230418

0.006286

Up

HOXC5

1.236194

0.006291

Up

KRTAP13-4

1.202792

0.006315

Up

OR3A2

− 1.250913

0.006384

Down

SRSF6

1.240448

0.006389

Up

GTSF1L

− 1.204976

0.006532

Down

SYNCRIP

1.229937

0.006571

Up

HIST1H2BO

1.347018

0.006699

Up

EPC2

1.212558

0.006748

Up

CTDSPL2

1.229495

0.006768

Up

OR10A3

− 1.206131

0.006817

Down

KRTAP7-1

− 1.297287

0.006896

Down

THOC2

− 1.220789

0.006979

Down

ETF1

1.225052

0.006984

Up

TC11000974.hg.1

− 1.273131

0.006994

Down

PRELID1

1.210411

0.007014

Up

IGHV3-38

− 1.267673

0.007029

Down

OR1L3

− 1.275722

0.007034

Down

SRP54

1.294575

0.007117

Up

EXOC5

1.217832

0.007122

Up

OR2H2

− 1.263243

0.007292

Down

OR2H2

− 1.263243

0.007292

Down

RNF122

1.27436

0.007373

Up

PTBP2

− 1.249936

0.007644

Down

ERP44

1.208521

0.007683

Up

CCR7

− 1.217568

0.007747

Down

QKI

1.209051

0.008013

Up

ZFP42

− 1.215171

0.008141

Down

IGLV3-22

− 1.215548

0.008195

Down

DEFB103A

− 1.213104

0.008451

Down

OR3A3

− 1.258226

0.008495

Down

TOP2B

1.206659

0.008697

Up

PTEN

1.221197

0.008785

Up

IGHV3-66

− 1.226136

0.008839

Down

PPP6C

1.210188

0.008908

Up

PRAMEF8

− 1.238928

0.008923

Down

STRN3

1.291297

0.008948

Up

TC01003841.hg.1

− 1.354102

0.008997

Down

TC05001047.hg.1

− 1.208467

0.009046

Down

MAGT1

1.21942

0.00909

Up

OR2H2

− 1.252699

0.009179

Down

OR2H2

− 1.252699

0.009179

Down

OR2H2

− 1.252699

0.009179

Down

RPL4

− 1.201599

0.009336

Down

OSTC

1.203947

0.009622

Up

IKZF5

1.216696

0.009868

Up

KRTAP10-11

− 1.205771

0.009912

Down

NLK

1.209405

0.009932

Up

OR2W1

1.274304

0.009978

Up

OR2W1

1.274304

0.009978

Up

OR2W1

1.274304

0.009978

Up

OR2W1

1.274304

0.009978

Up

OR2W1

1.274304

0.009978

Up

OR2W1

1.274304

0.009978

Up

OR2W1

1.274304

0.009978

Up

OR2W1

1.274304

0.009978

Up

CD248

1.239436

0.010758

Up

HIST1H4F

1.204154

0.010876

Up

OR6C1

− 1.216993

0.010911

Down

TMEM202

− 1.213705

0.011093

Down

TP53INP1

− 1.205295

0.011329

Down

KPNA3

1.21541

0.011511

Up

C7orf66

− 1.226557

0.011919

Down

TMSB4XP4

1.260484

0.011964

Up

TRAV24

− 1.229097

0.012215

Down

WDR26

1.201142

0.012239

Up

KRTAP9-3

− 1.229216

0.012293

Down

CSNK1A1L

1.212513

0.012716

Up

TC08001202.hg.1

− 1.327872

0.013076

Down

TAS2R16

− 1.212834

0.013287

Down

IGHV1-8

1.229339

0.013312

Up

RAB2A

1.248861

0.013563

Up

GPRIN2

− 1.234909

0.014257

Down

DEFB118

− 1.270079

0.014778

Down

TC07000141.hg.1

− 1.33934

0.015

Down

TC02000056.hg.1

− 1.236353

0.015231

Down

LCE1D

− 1.234952

0.015432

Down

FAM218A

1.265433

0.015487

Up

LCE2B

− 1.208788

0.015511

Down

CRABP1

− 1.271706

0.015536

Down

OR1F1

− 1.231414

0.015841

Down

LOC100144595

− 1.207195

0.016023

Down

GALNT1

1.247945

0.016274

Up

LEP

− 1.236716

0.016746

Down

DEFB136

− 1.203294

0.017223

Down

TC07000218.hg.1

− 1.256974

0.017302

Down

PPIAL4E

1.263803

0.02144

Up

USP17

1.21594

0.026188

Up

Gene symbol

Fold change

p-value

Gene feature

(C) Genes up/down-regulated in non-purified lung TCsSV40 compared with non-purified primary lung TCs

HSPA5

2.28735

5.20E−05

Up

BNC1

1.464673

5.70E−05

Up

CAPN6

− 1.711607

6.20E−05

Down

HOXC6

1.334235

6.60E−05

Up

COL12A1

1.349599

7.10E−05

Up

IGFBP7

1.60287

7.60E−05

Up

GATA6

1.812957

8.10E−05

Up

SLIT3

1.453596

8.60E−05

Up

ANGPTL7

1.780209

9.10E−05

Up

COL5A2

1.723719

9.60E−05

Up

COL1A1

1.699369

0.000101

Up

PPARGC1A

− 1.461747

0.000106

Down

MEIS2

1.482364

0.000111

Up

SYVN1

1.426147

0.000116

Up

MYH10

1.457796

0.000121

Up

MED12

− 1.423327

0.000126

Down

SMO

− 1.306238

0.00013

Down

DNM1

− 1.263174

0.000135

Down

ERO1L

1.270922

0.00014

Up

PBX1

− 1.307252

0.000145

Down

THBS1

1.469591

0.00015

Up

FBN1

1.535712

0.000155

Up

TRBV21OR9-2

− 1.373795

0.00016

Down

PTPRD

1.295981

0.000165

Up

BICC1

1.467091

0.00017

Up

DUSP6

1.245629

0.000175

Up

TXNIP

1.314454

0.00018

Up

FOXP2

1.294122

0.000185

Up

COL1A2

1.44837

0.00019

Up

ACTA1

1.287627

0.000195

Up

SEMA3A

− 1.310532

0.000199

Down

DES

1.335159

0.000204

Up

REXO2

1.380366

0.000209

Up

ACTN1

1.352297

0.000214

Up

VCL

1.66324

0.000219

Up

PCDH19

− 1.617275

0.000224

Down

SLC6A8

− 1.239617

0.000229

Down

PCDH17

− 1.932881

0.000239

Down

OGT

− 1.657267

0.000244

Down

HOXB5

− 1.442975

0.000249

Down

SEMA3D

1.383364

0.000254

Up

MECOM

− 1.327861

0.000259

Down

WT1

1.349575

0.000263

Up

KCNAB1

1.210026

0.000268

Up

RUNX1T1

− 1.360214

0.000273

Down

PLCE1

1.209156

0.000278

Up

COL3A1

1.499792

0.000283

Up

FAM102B

− 1.353459

0.000288

Down

MBD6

− 1.351938

0.000293

Down

CRYBA1

− 1.269111

0.000298

Down

ANXA6

1.224881

0.000303

Up

PCDH7

1.650618

0.000308

Up

PLXDC2

1.3089

0.000313

Up

FST

1.553608

0.000318

Up

NUAK1

1.27549

0.000323

Up

COL4A5

1.276706

0.000327

Up

IGF1

1.254137

0.000332

Up

SEC23A

1.389357

0.000337

Up

ATP1B1

1.276224

0.000342

Up

HS6ST2

1.230549

0.000347

Up

ZNF462

1.218491

0.000352

Up

FAM218A

1.448595

0.000357

Up

SEC23B

1.258266

0.000362

Up

PLOD2

1.25462

0.000367

Up

DNAJC1

1.413719

0.000372

Up

RAPH1

1.369576

0.000377

Up

GRIA3

1.691491

0.000382

Up

PSMC4

1.341278

0.000387

Up

SEC24A

1.317102

0.000391

Up

TGFB1I1

1.214649

0.000396

Up

ELAVL2

− 1.263137

0.000401

Down

NRP2

− 1.307128

0.000406

Down

KIAA1199

1.371075

0.000411

Up

LPHN3

− 1.212789

0.000421

Down

ARRDC3

− 1.350686

0.000426

Down

KLHL13

1.212748

0.000431

Up

MYO1D

1.385837

0.000436

Up

TM9SF3

1.307262

0.000441

Up

TFAP2A

− 1.274332

0.000446

Down

ARL6IP1

1.244781

0.000451

Up

CPXM1

1.300338

0.000455

Up

CCND2

− 1.241703

0.00046

Down

SPTLC2

1.354194

0.000465

Up

NNAT

1.392895

0.00047

Up

STK39

1.540497

0.000475

Up

ITGAV

1.267551

0.00048

Up

LTBP1

− 1.280112

0.000485

Down

CELF4

1.232625

0.00049

Up

OSBP

1.424925

0.000495

Up

MASP1

− 1.219414

5.00E−04

Down

FRMD5

− 1.36697

0.000505

Down

AP3S1

1.258065

0.00051

Up

BNC2

− 1.294519

0.000515

Down

TRPS1

− 1.34803

0.000519

Down

TUBG2

1.223767

0.000529

Up

CNN1

1.210395

0.000544

Up

TNC

1.281125

0.000549

Up

GBF1

1.314328

0.000554

Up

NFAT5

− 1.519776

0.000559

Down

NFIA

1.498716

0.000564

Up

ADAM22

1.202425

0.000584

Up

RBPJ

− 1.246466

0.000588

Down

EGR1

− 1.356633

0.000593

Down

ILDR2

1.458561

0.000603

Up

FSCN1

1.213951

0.000608

Up

VGLL3

1.201156

0.000623

Up

HIF1A

1.377011

0.000633

Up

ATP2A2

1.25653

0.000638

Up

ARF6

1.256706

0.000648

Up

NETO1

1.206084

0.000662

Up

PLK1

1.239207

0.000667

Up

CAV1

− 1.227122

0.000682

Down

ATF6

1.278798

0.000697

Up

ATP1A1

1.260299

0.000702

Up

GPC3

1.252397

0.000707

Up

HSPA4

1.310919

0.000716

Up

MAP4K4

1.293954

0.000721

Up

HOXC4

1.528822

0.000736

Up

JAG1

1.203931

0.000746

Up

INPPL1

1.248465

0.000756

Up

FOSB

− 1.204723

0.000766

Down

KMT2D

− 1.228557

0.000771

Down

PRPF19

1.227842

0.000776

Up

CCDC80

1.225889

0.00079

Up

TM9SF4

1.256719

0.000805

Up

NXN

1.219999

0.00081

Up

COPB1

1.27883

0.00082

Up

SRPX

1.337622

0.000825

Up

SMAD7

1.390506

0.00083

Up

VPS25

1.267452

0.000835

Up

TC18000270.hg.1

1.241506

0.000844

Up

DDX26B

− 1.386832

0.000854

Down

SCD

1.222675

0.000859

Up

KMT2A

− 1.233077

0.000869

Down

JUNB

− 1.289174

0.000874

Down

OR10P1

− 1.222678

0.000884

Down

LPCAT3

1.33701

0.000894

Up

ARHGAP1

1.390092

0.000909

Up

GRIA4

1.313269

0.000928

Up

GGCX

1.210524

0.000948

Up

CNIH

1.326625

0.000958

Up

SPARC

1.31356

0.000963

Up

S100A2

− 1.206393

0.000968

Down

THBS2

1.201097

0.000973

Up

MEF2A

1.231751

0.000977

Up

HOXC8

1.40158

0.000987

Up

SARS

− 1.216959

0.001002

Down

HOXC4

1.205214

0.001017

Up

FEZ1

− 1.210057

0.001022

Down

HDGFRP3

1.360953

0.001027

Up

SMAD6

1.248102

0.001032

Up

EGR3

− 1.413218

0.001037

Down

LPL

1.241889

0.001046

Up

CREB3L1

1.208352

0.001051

Up

EXT1

1.352789

0.001066

Up

SERPINH1

1.267578

0.001071

Up

CDH11

1.256532

0.001076

Up

FAM126A

− 1.231349

0.001086

Down

ZNF521

− 1.298692

0.00111

Down

PCDH18

− 1.284827

0.00113

Down

ACTN4

1.348564

0.00114

Up

C10orf53

− 1.240495

0.00115

Down

EMX2

1.428467

0.001155

Up

TUBG1

1.240367

0.001169

Up

PLAG1

− 1.253787

0.001194

Down

NEO1

1.311703

0.001209

Up

NR2F2

− 1.327418

0.001214

Down

RAB39B

− 1.208364

0.001229

Down

LCE1C

− 1.227094

0.001234

Down

NPR2

− 1.277907

0.001243

Down

APH1A

1.202275

0.001248

Up

PRR9

− 1.473668

0.001263

Down

FAM168A

1.316093

0.001273

Up

LOX

1.233141

0.001278

Up

ETV6

1.225393

0.001283

Up

MBNL1

− 1.348394

0.001312

Down

ZSWIM6

1.360747

0.001327

Up

GPM6B

− 1.209186

0.001342

Down

FERMT2

1.204761

0.001347

Up

ISM1

1.222367

0.001357

Up

HECTD1

1.325901

0.001366

Up

GPC6

1.249832

0.001371

Up

SPRR1A

− 1.304855

0.001376

Down

C17orf47

− 1.210708

0.001381

Down

POLA1

− 1.278784

0.001396

Down

RNF114

1.215485

0.001406

Up

PHLDB2

1.22064

0.001421

Up

BTG1

− 1.419463

0.001435

Down

OR2H2

− 1.386141

0.00146

Down

RAB6A

1.218989

0.00147

Up

STK19

− 1.226269

0.001482

Down

STK19

− 1.226269

0.001482

Down

EFNB1

1.214243

0.00149

Up

HIPK3

1.272379

0.001514

Up

OR2H2

− 1.336272

0.001524

Down

OR4X2

− 1.231192

0.001539

Down

ZNF503

1.203437

0.001554

Up

ABI1

1.207101

0.001568

Up

FAM188A

1.354332

0.001578

Up

MBNL2

1.315575

0.001593

Up

CDH2

1.263605

0.001618

Up

FAM98A

1.272083

0.001652

Up

DDB1

1.233239

0.001691

Up

TC11000975.hg.1

− 1.370641

0.001696

Down

DEFB128

− 1.229163

0.001701

Down

CYP51A1

1.215873

0.001706

Up

EFNA5

1.525255

0.001711

Up

CLINT1

1.352971

0.001721

Up

TCF4

− 1.350334

0.001736

Down

INTS5

1.272327

0.001741

Up

GATM

1.354506

0.00177

Up

GABRA3

1.32631

0.001775

Up

RAB1A

1.472237

0.001785

Up

TC02001150.hg.1

1.202559

0.001795

Up

CAMK2N2

1.205549

0.0018

Up

HNRNPUL2

1.26108

0.001815

Up

FGF18

1.254064

0.001829

Up

LCE3B

− 1.20559

0.001849

Down

SRPR

1.282511

0.001859

Up

RNF138

1.200216

0.001864

Up

GABRB1

1.20311

0.001869

Up

ZDHHC2

1.231848

0.001879

Up

PTGS2

− 1.235944

0.001888

Down

ANGPT1

− 1.239367

0.001923

Down

CDC27

1.301846

0.001933

Up

ZFP36L2

− 1.309184

0.001957

Down

THOC2

− 1.298345

0.001972

Down

AMMECR1L

1.204913

0.001982

Up

TAGLN

1.21811

0.001997

Up

SPRR1B

− 1.386398

0.002007

Down

ADAMTS6

− 1.251192

0.002021

Down

LCE3E

− 1.238425

0.002036

Down

TEAD1

1.316471

0.00209

Up

OR4D11

− 1.397758

0.002115

Down

PSMD14

1.269457

0.002164

Up

INSL6

1.241962

0.002169

Up

FBXO33

1.240947

0.002174

Up

OR2H2

− 1.335922

0.002211

Down

OR2H2

− 1.335922

0.002211

Down

LCE1D

− 1.24485

0.002233

Down

STIM1

1.291974

0.002253

Up

TRBV6-8

− 1.383088

0.002297

Down

PARVA

1.212507

0.002307

Up

TC11000974.hg.1

− 1.355331

0.002322

Down

CTGF

1.278251

0.002327

Up

PRKG1

1.245661

0.002341

Up

TLN1

1.209426

0.002356

Up

OR3A2

− 1.258635

0.002361

Down

NPR3

1.252907

0.002366

Up

CYGB

1.286596

0.002376

Up

ID1

1.302257

0.002396

Up

HSPA2

1.291744

0.002401

Up

DERL2

1.338707

0.002415

Up

OR2H2

− 1.331198

0.002469

Down

OR2H2

− 1.331198

0.002469

Down

OR2H2

− 1.331198

0.002469

Down

EIF4G2

1.351151

0.002548

Up

PAPOLA

1.311535

0.002578

Up

PPP3R1

1.259841

0.002588

Up

PDIA3

1.321177

0.002597

Up

HSP90B1

1.297674

0.002627

Up

EIF4A1

1.248301

0.002642

Up

TNPO3

− 1.20247

0.002676

Down

UCP2

1.245612

0.002686

Up

EEF1G

1.228255

0.00274

Up

TC13000014.hg.1

− 1.237888

0.002745

Down

TC02002617.hg.1

− 1.519734

0.00275

Down

PFN1

1.248818

0.00276

Up

ERLEC1

1.219854

0.00277

Up

GSPT1

1.296726

0.002878

Up

TC15001723.hg.1

− 1.244628

0.002883

Down

C8orf49

− 1.225571

0.002888

Down

STAT3

1.204904

0.002957

Up

MAN1A1

1.22109

0.002982

Up

ACTR1A

1.210577

0.003046

Up

TAF10

1.234009

0.003075

Up

ONECUT2

− 1.203425

0.0031

Down

PPP2R5E

1.303497

0.003105

Up

STT3A

1.268152

0.003115

Up

TC03001641.hg.1

− 1.243194

0.003134

Down

TGFB3

1.241756

0.003159

Up

DICER1

1.208135

0.003164

Up

LCE2A

− 1.356188

0.003213

Down

HIST1H4J

1.203634

0.003257

Up

P4HA1

1.268543

0.003277

Up

TCF20

− 1.200225

0.003287

Down

HOXC5

1.25077

0.003302

Up

MTX2

1.203709

0.003316

Up

MUT

− 1.206951

0.003376

Down

CPD

1.217165

0.003405

Up

PRELP

− 1.216805

0.00343

Down

OR10D3

− 1.289554

0.003558

Down

EFNB2

1.322603

0.003563

Up

MBTPS2

− 1.219406

0.003577

Down

ACVR2A

1.277435

0.003632

Up

PCDH10

1.289149

0.003641

Up

OR3A3

− 1.294084

0.003676

Down

VAT1L

1.224017

0.003681

Up

ANKIB1

1.250405

0.003705

Up

ATP6AP2

− 1.203066

0.003829

Down

TMSB10

1.33115

0.003893

Up

MYL9

1.238522

0.003976

Up

P4HA3

1.223749

0.004006

Up

LOC100144595

− 1.210771

0.004045

Down

CCDC47

1.254626

0.004085

Up

PTP4A1

1.207393

0.004104

Up

SNX12

− 1.231653

0.004163

Down

TC03000927.hg.1

− 1.34441

0.004173

Down

PRAMEF10

− 1.226358

0.004218

Down

HIST1H2BF

1.201242

0.004331

Up

HIST1H4F

1.278307

0.004355

Up

LSM2

− 1.23126

0.00436

Down

PSMC6

1.28439

0.00437

Up

TMEM57

1.214675

0.00438

Up

TRGV8

− 1.24305

0.004449

Down

SEC11A

1.212858

0.004508

Up

OR51B6

− 1.25219

0.004528

Down

ZNF830

1.223738

0.004552

Up

TMEM238

1.259086

0.004582

Up

TOP1

1.207832

0.004685

Up

LELP1

− 1.254685

0.004764

Down

MMD

1.342077

0.004774

Up

LCE1A

− 1.207411

0.004804

Down

IGKV1D-13

− 1.253243

0.004808

Down

FZD8

1.20833

0.004853

Up

OR5A2

− 1.583233

0.004887

Down

C1QL3

1.202082

0.005015

Up

PANK3

1.209123

0.00506

Up

KIF5B

1.306357

0.005094

Up

SRP54

1.335205

0.005153

Up

ETF1

1.247056

0.005385

Up

HIST1H4G

1.221559

0.005399

Up

TRIP12

1.250366

0.005463

Up

TRAJ59

1.280347

0.005591

Up

DEFB133

− 1.217544

0.00568

Down

HIST1H2BH

1.324812

0.005739

Up

ACTL8

− 1.34524

0.005828

Down

HIST1H2BO

1.331009

0.005867

Up

C16orf87

1.227019

0.005877

Up

HIST1H1B

1.236488

0.005971

Up

PPP3CA

1.2093

0.006

Up

DAZAP2

− 1.246936

0.006069

Down

C7orf66

− 1.257301

0.006168

Down

IRF2BPL

1.222737

0.006197

Up

USP12

1.245254

0.006202

Up

PGAP2

− 1.236121

0.006217

Down

WNK1

− 1.317909

0.006315

Down

FAR1

1.239903

0.006424

Up

HOXA2

1.321485

0.006497

Up

IGHV3-48

− 1.200801

0.006537

Down

LCE2C

− 1.207171

0.006714

Down

PPIC

1.208975

0.006822

Up

COPA

1.213652

0.006847

Up

SPANXN3

1.276398

0.006916

Up

DCUN1D5

1.204299

0.006931

Up

RAP1B

1.238418

0.006946

Up

CMAS

1.312695

0.007064

Up

NLK

1.232188

0.007211

Up

HIST1H2BE

1.335735

0.007216

Up

HRNR

− 1.31544

0.007221

Down

OR4A16

1.208665

0.007285

Up

C8orf48

1.252595

0.007477

Up

CSNK1A1

1.214353

0.007497

Up

UBE2M

1.219256

0.00761

Up

ZNF281

1.250794

0.007817

Up

IGHD2-21

− 1.332138

0.007837

Down

E2F3

1.206829

0.008019

Up

TC10000913.hg.1

− 1.226511

0.008108

Down

NCKAP1

1.22608

0.008285

Up

PPP6C

1.215357

0.008364

Up

SEC62

1.25965

0.008536

Up

EXOC5

1.207899

0.00862

Up

FKBP1C

1.20189

0.008787

Up

ZBTB6

1.223895

0.008964

Up

TRBV6-7

− 1.261291

0.009048

Down

DEFB136

− 1.297342

0.009122

Down

FGF10

− 1.247986

0.009186

Down

OR4C6

1.293432

0.00927

Up

GFPT1

1.20605

0.009309

Up

PSMA6

1.216218

0.009353

Up

TC01002282.hg.1

− 1.202154

0.009477

Down

KRTAP9-8

− 1.222393

0.009486

Down

LCE2B

− 1.251225

0.009595

Down

TC17000686.hg.1

− 1.224599

0.009846

Down

TMSB4XP4

1.276305

0.009935

Up

LOC100509638

− 1.228863

0.010215

Down

OR51L1

− 1.209919

0.010486

Down

TC07000141.hg.1

− 1.389386

0.011299

Down

USP17

1.231161

0.011338

Up

BMPR1A

1.225957

0.011535

Up

IGHV1OR21-1

− 1.207255

0.011811

Down

LOC728819

1.209199

0.011968

Up

WDR26

1.21391

0.012145

Up

TC15001075.hg.1

− 1.206125

0.012165

Down

TRAPPC1

1.207842

0.012264

Up

STRN3

1.251923

0.012589

Up

IGKV1D-37

1.290804

0.012667

Up

TC05000944.hg.1

− 1.209012

0.012855

Down

KRTAP6-3

− 1.209466

0.013017

Down

TC01001567.hg.1

− 1.220919

0.013106

Down

TC08000204.hg.1

− 1.257586

0.013199

Down

TRAV24

− 1.224177

0.013224

Down

KPNA3

1.208042

0.013244

Up

CALHM1

− 1.281085

0.01346

Down

KRTAP5-6

− 1.213396

0.013514

Down

OR5W2

− 1.227139

0.013682

Down

HIST2H2BE

1.203613

0.013928

Up

TAOK1

1.203131

0.014223

Up

RBMXL2

1.242693

0.014371

Up

MGC15705

1.248494

0.014499

Up

NOP58

1.210344

0.014898

Up

TC01003841.hg.1

− 1.272609

0.014947

Down

CASK

− 1.202663

0.015371

Down

GPX5

− 1.231507

0.015435

Down

IGLJ6

− 1.209384

0.015651

Down

OR6C1

− 1.220835

0.015715

Down

OR1L3

− 1.26804

0.015981

Down

IGKV1-9

− 1.205738

0.016425

Down

CSNK1A1L

1.236726

0.016981

Up

OR51A4

− 1.251899

0.017158

Down

TC07000847.hg.1

1.200866

0.017404

Up

TAS2R16

− 1.220859

0.017424

Down

EIF2S2

1.202591

0.018104

Up

RAB2A

1.218567

0.018571

Up

OR56A5

1.204074

0.022471

Up

Gene symbol

Fold change

p-value

Gene feature

(D) Genes up/down-regulated in purified TCsSV40 compared with non-purified lung TCsSV40

ZBTB18

− 1.554972

0.000298

Down

MID2

− 1.541494

0.000126

Down

HSPA5

− 1.518909

0.000465

Down

TSC22D2

− 1.5017

0.00048

Down

VCL

− 1.495358

0.000204

Down

MEIS2

− 1.460638

8.60E−05

Down

STK39

− 1.423681

0.000313

Down

CTGF

− 1.421299

0.000268

Down

DOCK11

− 1.415118

0.000426

Down

ATF6

− 1.409588

0.000199

Down

SLC7A11

− 1.404048

0.000101

Down

BRAF

− 1.396899

0.000755

Down

NLK

− 1.384761

0.00076

Down

ERO1L

− 1.366172

5.20E−05

Down

HIST1H2BE

− 1.360048

0.003083

Down

MEF2A

− 1.354049

0.000135

Down

CELF1

− 1.34869

0.000706

Down

HPRT1

− 1.348486

0.001415

Down

TBPL1

− 1.344601

0.000573

Down

FAM188A

− 1.344027

0.000652

Down

AZIN1

− 1.322403

0.000288

Down

SYVN1

− 1.309011

0.000145

Down

HIST1H2BO

− 1.308399

0.002104

Down

STRBP

− 1.307068

0.000362

Down

ABCB7

− 1.302327

0.00239

Down

EFNB2

− 1.298157

0.002606

Down

ANKRD1

− 1.293984

0.000455

Down

SLC6A9

− 1.292011

0.000244

Down

RND1

− 1.288509

0.000258

Down

HOXC4

− 1.286961

0.001459

Down

PGRMC1

− 1.285024

0.000775

Down

IGHV1-8

− 1.283244

0.003162

Down

GSPT1

− 1.277447

0.002286

Down

FN1

− 1.272748

0.001287

Down

AKT3

− 1.269844

0.000436

Down

STIM1

− 1.269255

0.00139

Down

EFNA5

− 1.268694

0.002818

Down

CCDC47

− 1.265588

0.001528

Down

DES

− 1.265153

0.00013

Down

PDZD8

− 1.258982

0.000696

Down

GATA6

− 1.253813

0.000637

Down

SEL1L

− 1.25119

0.000603

Down

HDGFRP3

− 1.249545

0.000947

Down

ZNF827

− 1.249169

0.000175

Down

NEO1

− 1.24814

0.001996

Down

MYH10

− 1.247444

0.00049

Down

C16orf87

− 1.247099

0.002311

Down

HES1

− 1.244124

0.000308

Down

HERPUD1

− 1.239348

0.000229

Down

DUSP6

− 1.237186

0.002138

Down

RAPH1

− 1.235005

0.000992

Down

CDC42BPA

− 1.233364

0.00203

Down

ACTN4

− 1.232684

0.00174

Down

ZNF462

− 1.232013

0.000111

Down

VPRBP

− 1.230287

0.00078

Down

RALGAPA1

− 1.229069

0.001804

Down

UPRT

− 1.229057

0.002852

Down

UBE2W

− 1.228348

0.000785

Down

SAMD4B

− 1.227886

0.000667

Down

MTRNR2L4

− 1.224725

0.00172

Down

SEC24A

− 1.224506

0.000421

Down

AMMECR1L

− 1.222428

0.00047

Down

PRKAA2

− 1.221814

0.003029

Down

ACTN1

− 1.218558

0.000623

Down

OSBP

− 1.217315

0.001464

Down

VLDLR

− 1.216913

0.000239

Down

MSI2

− 1.211676

0.000731

Down

MSN

− 1.209973

0.002842

Down

LRRC58

− 1.209927

0.000273

Down

COL4A5

− 1.209539

0.000317

Down

SLAIN2

− 1.207964

0.002094

Down

NDFIP1

− 1.206718

0.001932

Down

PPP2R5B

− 1.20442

0.001134

Down

VPS25

− 1.20254

0.00079

Down

CPD

− 1.201293

0.002626

Down

COLEC12

1.200894

0.00173

Up

THBS3

1.201895

0.000726

Up

KITLG

1.202163

0.000337

Up

SETBP1

1.202182

0.000765

Up

LOXL1

1.202879

0.001203

Up

PRKD1

1.20361

9.10E−05

Up

ZFP36L1

1.203909

0.001755

Up

EDDM3B

1.205244

0.001159

Up

ANGPT1

1.207484

0.001346

Up

MMP2

1.208515

0.000165

Up

FAM170B

1.210029

0.000923

Up

LELP1

1.213262

0.002473

Up

IGFBP4

1.215597

0.002011

Up

STC1

1.217133

0.000928

Up

EPHA7

1.218188

0.000568

Up

PRDM6

1.219262

0.000618

Up

ACTRT1

1.219685

0.001509

Up

XDH

1.222067

0.000209

Up

OR4D11

1.224206

0.000874

Up

HOXA11

1.22653

0.002001

Up

PAK3

1.228895

0.000381

Up

BNC2

1.242835

0.000303

Up

SLC16A2

1.248637

0.000593

Up

NRN1

1.251496

0.000564

Up

GDPD2

1.251704

0.000189

Up

RUNX1T1

1.251964

0.000352

Up

PCDH18

1.252101

0.000263

Up

PCDH9

1.255458

0.001848

Up

MMP16

1.25842

0.000155

Up

PRRX1

1.259453

0.001144

Up

LRP1

1.263799

0.000997

Up

SEMA5A

1.267548

7.10E−05

Up

PBX1

1.270348

0.000185

Up

RDH10

1.271163

6.60E−05

Up

VCAN

1.277158

0.000121

Up

HOXB8

1.284619

0.00016

Up

FOXG1

1.287872

0.001824

Up

MT1G

1.289954

0.000485

Up

SOCS3

1.291472

0.002252

Up

TBX4

1.309269

0.00017

Up

ADAMTS15

1.313557

0.000278

Up

FGF7

1.320284

0.000805

Up

HOXA5

1.322982

0.00144

Up

MME

1.331844

0.00015

Up

DBC1

1.332864

8.10E−05

Up

ZEB2

1.333152

0.000249

Up

LTBP1

1.335297

0.00018

Up

BTG1

1.338416

0.00112

Up

MT1H

1.346673

0.000327

Up

UGCG

1.347608

9.60E−05

Up

TCF4

1.350209

0.000559

Up

MEIS1

1.358188

0.000445

Up

BHLHE22

1.358601

0.00014

Up

MT1B

1.367849

0.000539

Up

TSHZ1

1.396499

0.000106

Up

FGF10

1.434899

5.00E−04

Up

ARRDC3

1.438034

0.000194

Up

FIGN

1.458516

0.000253

Up

NR2F2

1.464969

0.000549

Up

ZNF521

1.487048

0.000283

Up

GPM6B

1.570568

7.60E−05

Up

HOXB5

1.727273

5.70E−05

Up

FRMD5

1.736738

6.20E−05

Up

SFRP2

1.894966

0.000116

Up

Gene symbol

Fold change

p-value

Gene feature

(E) Genes up/down-regulated in purified TCsSV40 compared with purified primary lung TCs

COL3A1

2.033893

5.20E−05

Up

FST

1.763096

5.70E−05

Up

SLIT3

1.476233

6.20E−05

Up

COL1A1

1.754216

6.60E−05

Up

FRMD5

1.529829

7.10E−05

Up

FBN1

1.662323

7.60E−05

Up

ZFP36L1

1.546307

8.10E−05

Up

TNC

1.410268

8.60E−05

Up

PCDH7

1.75739

9.10E−05

Up

DBC1

1.550832

9.60E-05

Up

MMP2

1.365924

0.000101

Up

NNAT

1.470003

0.000106

Up

STAT3

1.55145

0.000111

Up

KLHDC10

− 1.299299

0.000116

Down

KIAA1199

1.437971

0.000121

Up

BHLHE22

1.541751

0.000126

Up

SPRY2

1.451741

0.00013

Up

LOXL1

1.602346

0.000135

Up

TSHZ1

1.635298

0.00014

Up

COL5A2

1.534133

0.000145

Up

HOXA2

1.907531

0.00015

Up

FGF10

1.384277

0.000155

Up

COL12A1

1.291331

0.00016

Up

ZNF503

1.448549

0.000165

Up

NID1

1.254112

0.00017

Up

NFIX

1.50204

0.000175

Up

ANGPTL7

1.516574

0.00018

Up

COL1A2

1.516627

0.000185

Up

IGFBP7

1.527419

0.000189

Up

MEIS1

1.661917

0.000194

Up

ILDR2

1.354674

0.000199

Up

IER5L

1.407578

0.000204

Up

HMGCS1

1.325093

0.000209

Up

CALM3

1.256977

0.000214

Up

CELF2

1.661174

0.000219

Up

PCDH10

1.601334

0.000224

Up

NDST1

1.200203

0.000229

Up

CPXM1

1.387893

0.000234

Up

PPARGC1A

− 1.43313

0.000239

Down

ZEB2

1.389745

0.000244

Up

SPRR1B

− 1.417133

0.000249

Down

MMP16

1.351496

0.000253

Up

RNF150

1.301929

0.000258

Up

LOX

1.275704

0.000263

Up

CBX6

1.291217

0.000273

Up

ZNF521

1.642922

0.000278

Up

MME

1.32368

0.000283

Up

GDPD2

1.247925

0.000288

Up

FMR1

1.627765

0.000293

Up

PDGFRA

1.21296

0.000298

Up

C3orf58

1.227127

0.000303

Up

SFRP2

2.026877

0.000308

Up

FBLN2

1.287435

0.000313

Up

CYP51A1

1.229665

0.000317

Up

ARF6

1.234812

0.000322

Up

RBPJ

− 1.345805

0.000327

Down

GPM6B

1.420512

0.000332

Up

NFIA

1.616514

0.000337

Up

MBD6

− 1.277385

0.000342

Down

EXT1

1.446781

0.000347

Up

MID2

− 1.366576

0.000352

Down

LRP6

1.5391

0.000357

Up

BICC1

1.448877

0.000362

Up

WT1

1.215831

0.000367

Up

CHD3

1.226874

0.000372

Up

THBS1

1.572993

0.000377

Up

UPRT

− 1.413812

0.000381

Down

NLGN2

1.224543

0.000386

Up

NXN

1.274044

0.000391

Up

MED12

− 1.307768

0.000396

Down

LRP1

1.46219

0.000401

Up

HOXB5

1.333689

0.000406

Up

KLF7

1.264161

0.000411

Up

ACLY

1.361581

0.000416

Up

RDH10

1.355596

0.000421

Up

DPYSL2

1.315251

0.000431

Up

PRRX1

1.553947

0.000436

Up

LPHN2

1.258686

0.00044

Up

GATA6

1.43309

0.000445

Up

CDH11

1.32449

0.00045

Up

PRG4

1.243068

0.000455

Up

PCDH17

− 1.543509

0.00046

Down

NFIB

1.600764

0.000465

Up

VCAN

1.21944

0.00047

Up

FAM98A

1.298444

0.000475

Up

EFEMP1

1.226158

0.00048

Up

FOXP2

1.205803

0.000485

Up

PCDHGC5

1.331799

5.00E−04

Up

THBS2

1.266764

0.000504

Up

HIF1A

1.440204

0.000509

Up

IGFBP4

1.30241

0.000514

Up

MARK1

1.233597

0.000519

Up

KMT2D

− 1.200632

0.000524

Down

SCD

1.32132

0.000534

Up

LPCAT3

1.43367

0.000539

Up

TBPL1

− 1.393924

0.000544

Down

PDE1A

1.230559

0.000554

Up

GRIA3

1.359144

0.000564

Up

EFEMP2

1.222385

0.000568

Up

TCF20

− 1.318507

0.000573

Down

PDE7B

1.556907

0.000578

Up

HTRA1

− 1.270642

0.000583

Down

HOXA5

1.58066

0.000593

Up

CYB5R1

− 1.258022

0.000603

Down

SETBP1

1.318692

0.000608

Up

CACNA1C

1.265093

0.000613

Up

ADAMTS2

1.224627

0.000618

Up

DOCK9

− 1.215588

0.000623

Down

OGT

− 1.564357

0.000632

Down

COLEC12

1.376494

0.000637

Up

ZBTB18

− 1.778186

0.000642

Down

KITLG

1.25933

0.000647

Up

GFPT2

1.276106

0.000652

Up

GABRA3

1.435938

0.000657

Up

SLC16A2

1.320833

0.000662

Up

PCDHB1

− 1.242627

0.000667

Down

EPHA7

1.315288

0.000677

Up

SLCO3A1

1.220403

0.000682

Up

DDX26B

− 1.214763

0.000687

Down

SEMA3D

1.235461

0.000692

Up

ADAMTS15

1.389205

0.000696

Up

MAN1A1

1.226513

0.000701

Up

TCF7L2

1.319781

0.000706

Up

PBX3

1.27527

0.000711

Up

SLIT2

1.356085

0.000721

Up

TENM4

− 1.247945

0.000731

Down

PARP6

− 1.252561

0.000736

Down

KLF9

1.320073

0.000755

Up

IGF1

1.441883

0.00076

Up

HOXB8

1.273005

0.00077

Up

ARID5B

1.28496

0.000775

Up

PKM

1.322278

0.00078

Up

BMP1

1.215932

0.000785

Up

PCDH19

− 1.416186

0.000795

Down

FEZ1

− 1.257686

8.00E−04

Down

NPR2

− 1.26446

0.00081

Down

STRBP

− 1.352471

0.000819

Down

DNAJC1

1.241378

0.000824

Up

WNK1

− 1.574397

0.000829

Down

DHCR24

1.236232

0.000844

Up

EGR1

− 1.325378

0.000849

Down

MT1M

1.25661

0.000864

Up

AKAP8L

− 1.20015

0.000874

Down

ATP1B1

1.211897

0.000879

Up

GATM

1.291347

0.000883

Up

TRBV6-8

− 1.35926

0.000893

Down

FZD8

1.649274

0.000903

Up

AHCYL2

− 1.206907

0.000913

Down

PPP3CA

1.344731

0.000918

Up

SURF4

1.211797

0.000923

Up

CCND2

− 1.224408

0.000938

Down

RAB11B

1.26997

0.000943

Up

FHL1

1.202305

0.000952

Up

TOX

1.397482

0.000957

Up

FOXC1

1.242409

0.000967

Up

AIDA

1.274415

0.000977

Up

TNFAIP1

1.202941

0.000982

Up

THBS3

1.214669

0.000987

Up

CLMP

1.294055

0.000992

Up

DOCK3

− 1.231871

0.001002

Down

DDIT3

− 1.40635

0.001006

Down

GPC6

1.248637

0.001011

Up

ABCB7

− 1.307951

0.001016

Down

ETV6

1.353185

0.001026

Up

CHKA

− 1.240302

0.001051

Down

R3HDM2

− 1.252354

0.001061

Down

TLN1

1.226184

0.001085

Up

PFN1

1.394161

0.00109

Up

ADAMTS4

1.218343

0.001095

Up

CLIP3

1.213372

0.0011

Up

ILK

1.304537

0.00111

Up

PLXDC2

1.301745

0.00113

Up

PABPC4

− 1.218394

0.001134

Down

NR2F2

1.485732

0.001174

Up

PPAP2B

1.278773

0.001189

Up

FIGN

1.399002

0.001198

Up

SPARC

1.228554

0.001223

Up

AKT3

− 1.215306

0.001233

Down

TC10000913.hg.1

− 1.44934

0.001238

Down

RHOT1

− 1.311667

0.001243

Down

NUAK1

1.245725

0.001253

Up

SOCS3

1.418689

0.001287

Up

TC02002617.hg.1

− 1.617442

0.001292

Down

TC07000141.hg.1

− 1.394869

0.001302

Down

MYO1D

1.296444

0.001307

Up

CDH2

1.216156

0.001317

Up

TCF4

1.260214

0.001321

Up

FUBP1

− 1.41599

0.001326

Down

ARRDC3

1.309616

0.001341

Up

CYGB

1.229195

0.001351

Up

TBX4

1.238548

0.001356

Up

MUT

− 1.208493

0.001361

Down

MT1H

1.423387

0.001371

Up

MBTPS2

− 1.36196

0.001381

Down

RAB1B

1.221867

0.00143

Up

AZIN1

− 1.289217

0.001435

Down

CNTFR

1.224893

0.001445

Up

NRN1

1.247028

0.001449

Up

PRPF19

1.221176

0.001469

Up

HPRT1

− 1.432868

0.001484

Down

PARVA

1.248515

0.001494

Up

MSN

− 1.307225

0.001499

Down

SPRR2F

− 1.204892

0.001509

Down

DOCK11

− 1.249159

0.001513

Down

H3F3A

1.288991

0.001518

Up

MAP4K3

1.215421

0.001528

Up

RGL1

1.23898

0.001543

Up

PSAT1

− 1.279406

0.001572

Down

BNC1

1.24342

0.001617

Up

HNRNPUL2

1.206099

0.001622

Up

MSI2

− 1.235799

0.001627

Down

FAM71B

1.244138

0.001656

Up

SEC23A

1.252503

0.001661

Up

CNOT6L

− 1.344862

0.001666

Down

CTDSP2

1.310633

0.001676

Up

FGF7

1.282848

0.001691

Up

MYH10

1.216826

0.001696

Up

EMP3

1.28252

0.00171

Up

SOX4

1.304636

0.00172

Up

NR4A3

1.23027

0.00175

Up

USP17

1.224951

0.00176

Up

LDB1

1.225476

0.001764

Up

ATF6

− 1.284147

0.001789

Down

ABI1

1.224035

0.001804

Up

P4HA3

1.256545

0.001814

Up

PTEN

1.427111

0.001838

Up

CCT2

− 1.25044

0.001843

Down

KMT2A

− 1.254142

0.001848

Down

ISM1

1.407921

0.001873

Up

DEFB113

− 1.306901

0.001878

Down

EFNA5

1.216599

0.001942

Up

RBP1

1.223532

0.002006

Up

HSPA9

− 1.22658

0.002015

Down

TRBV21OR9-2

− 1.275752

0.002035

Down

JHDM1D

− 1.22599

0.002089

Down

PRKAA2

− 1.288077

0.002109

Down

GPC3

1.209065

0.002129

Up

INTS5

1.218441

0.002158

Up

EPT1

− 1.215737

0.002163

Down

PAK3

1.209358

0.002178

Up

SARS

− 1.377121

0.002183

Down

MYL9

1.215861

0.002202

Up

CALR

1.328144

0.002217

Up

PLK1

1.234092

0.002222

Up

PDIA3

1.320796

0.002247

Up

C14orf1

1.234254

0.002266

Up

PRELID1

1.300632

0.002281

Up

TC01001567.hg.1

− 1.230659

0.002301

Down

SULF1

1.211791

0.002326

Up

CPSF6

− 1.256973

0.00234

Down

NR4A2

1.213443

0.002345

Up

NR1D1

− 1.219622

0.00235

Down

RAB5C

1.222135

0.002375

Up

REXO2

1.290263

0.002399

Up

LMO4

1.200112

0.002409

Up

GPR174

1.216642

0.002414

Up

AP2S1

1.217261

0.002419

Up

DYNLL2

1.251735

0.002449

Up

HUWE1

− 1.260641

0.002468

Down

VPRBP

− 1.26699

0.002473

Down

BMPR1A

1.33189

0.002478

Up

DIO3

1.203031

0.002493

Up

TM9SF4

1.216029

0.002547

Up

RAB1A

1.410474

0.002572

Up

CEBPB

1.214692

0.002577

Up

ACTR1A

1.216125

0.002606

Up

LOC100509638

− 1.209083

0.002611

Down

CHMP4B

1.224858

0.002636

Up

ARHGAP1

1.325099

0.00265

Up

HMGA1

− 1.240781

0.002655

Down

TOP1

1.272427

0.00267

Up

EGR3

− 1.295132

0.002675

Down

C9orf172

1.228614

0.002685

Up

ID3

1.245858

0.002695

Up

CD248

1.388851

0.0027

Up

FAM168B

1.234437

0.002768

Up

RCN3

1.226194

0.002783

Up

MT1A

1.288399

0.002798

Up

EIF4B

− 1.207714

0.002803

Down

GTPBP2

− 1.208847

0.002813

Down

TMSB10

1.386714

0.002847

Up

GABARAP

1.284343

0.002852

Up

IGHV3-38

− 1.236566

0.002916

Down

TC11000974.hg.1

− 1.267039

0.002931

Down

RAB39B

− 1.258083

0.002985

Down

MMP14

1.257854

0.003034

Up

NFAT5

− 1.270263

0.003069

Down

LCE3D

− 1.208922

0.003093

Down

TMTC2

1.248958

0.003108

Up

USP12

1.408625

0.003133

Up

ANKRD1

− 1.219365

0.003152

Down

RBBP5

− 1.210453

0.003172

Down

PTMA

1.251584

0.003197

Up

ACTA1

1.225395

0.003246

Up

RNF141

− 1.205359

0.00333

Down

FGFBP1

− 1.200483

0.003364

Down

RPL4

− 1.217294

0.003408

Down

CASK

− 1.354502

0.003413

Down

LCE3E

− 1.213158

0.003453

Down

EPC2

1.261066

0.003467

Up

NOXRED1

− 1.234805

0.003507

Down

MT1B

1.263775

0.003517

Up

CCR7

− 1.260932

0.003561

Down

BRAF

− 1.278428

0.003595

Down

RPS27

− 1.246149

0.0036

Down

HNRNPH2

1.328316

0.00361

Up

IGHV2-26

− 1.203819

0.00364

Down

DEFB115

− 1.226413

0.003679

Down

PTBP2

− 1.331489

0.003763

Down

RPS6KB1

1.216347

0.003896

Up

MT2A

1.290212

0.003935

Up

TARDBP

− 1.205193

0.003969

Down

SYT11

1.24811

0.004014

Up

MT1F

1.263703

0.004024

Up

SFRP1

1.245684

0.004053

Up

SEMA3A

− 1.202169

0.004073

Down

TC14000204.hg.1

1.20508

0.004122

Up

TSC22D2

− 1.302317

0.004127

Down

KCNJ2

1.282504

0.004176

Up

SPTLC2

1.242016

0.004309

Up

POLA1

− 1.263183

0.004373

Down

HIPK3

1.207585

0.004398

Up

HIST2H2AA4

1.242261

0.004407

Up

TEAD1

1.201058

0.004432

Up

FBXO33

1.217546

0.004471

Up

ENOX2

− 1.227983

0.00453

Down

OR5A2

− 1.31152

0.00455

Down

THOC2

− 1.305497

0.004555

Down

CAPN6

− 1.245443

0.004614

Down

ZNF281

1.297079

0.004624

Up

NFKBIA

1.21647

0.004649

Up

TBC1D19

− 1.208949

0.004683

Down

TC03000927.hg.1

− 1.21805

0.004688

Down

EDDM3B

1.206252

0.004693

Up

TC19000375.hg.1

− 1.233615

0.004703

Down

OR5AU1

− 1.225907

0.004752

Down

PSMA3

1.210788

0.004781

Up

PABPC1

− 1.24424

0.004796

Down

OR2AJ1

− 1.209642

0.004988

Down

PPIAL4A

1.303974

0.004993

Up

FIGF

1.222296

0.005082

Up

TP53INP1

− 1.227022

0.00519

Down

DNAJA2

1.20171

0.005215

Up

SAP30

1.223176

0.005254

Up

OR4F21

− 1.206284

0.005461

Down

OR1L3

− 1.211827

0.005485

Down

TBX15

1.209874

0.005638

Up

IPO7

− 1.287169

0.005751

Down

ACVR2A

1.227166

0.005889

Up

FOXG1

1.300571

0.005918

Up

AGFG1

1.205554

0.006032

Up

MURC

− 1.204566

0.006169

Down

OR10D3

− 1.304006

0.006337

Down

ADAMTS5

1.212932

0.006342

Up

EID3

1.207392

0.007065

Up

MT1G

1.209678

0.007784

Up

MSANTD2

− 1.200157

0.007966

Down

KDM6A

− 1.246053

0.007971

Down

DERL2

1.224813

0.008443

Up

HSPA5

1.242949

0.008561

Up

POM121L2

− 1.202141

0.009423

Down

CCIN

1.410994

0.009492

Up

TC11000975.hg.1

− 1.23782

0.009501

Down

SYNCRIP

1.202486

0.009526

Up

OR1F1

− 1.200102

0.009708

Down

TRAM1L1

1.227933

0.009723

Up

PPIAL4C

1.292198

0.009954

Up

TC11000959.hg.1

− 1.206482

0.010584

Down

KRTAP29-1

− 1.332407

0.010889

Down

TC07000218.hg.1

− 1.236963

0.011884

Down

ALX1

− 1.216059

0.012036

Down

HEXIM1

1.213559

0.012292

Up

OR10J5

− 1.31215

0.012991

Down

IGLJ4

1.339919

0.014029

Up

C10orf85

1.259314

0.014064

Up

RNF122

1.213118

0.014384

Up

PPIAL4C

1.217453

0.015481

Up

Gene symbol

p-value

q-value

Gene feature

(F) Genes up/down-regulated in purified primary lung TCs compared with non-purified primary lung TCs

ZNF521

5.20E−05

0

Down

NFIX

6.20E−05

0

Down

ZFP36L2

0.000263

0.038653

Down

NR2F2

0.00013

0

Down

SLIT2

7.60E−05

0

Down

NFIB

0.000155

0

Down

NFAT5

0.000288

0.038653

Down

LRP6

5.70E−05

0

Down

FAM102B

0.00019

0

Down

TCF4

0.000372

0.045591

Down

HES1

0.000406

0.045591

Down

PFN1

0.000387

0.045591

Down

TSHZ1

5.00E−04

0.04939

Down

SPRY2

0.000268

0.038653

Down

CTGF

9.10E−05

0

Down

ARRDC3

0.000244

0.038653

Down

LOXL1

0.000682

0.04939

Down

NLGN2

0.000116

0

Down

ZEB2

0.00017

0

Down

CTDSP2

0.00051

0.04939

Down

FBLN5

0.000293

0.038653

Down

FRMD5

0.000342

0.045591

Down

RGL1

0.000416

0.045591

Down

Table 2

Summary of LncRNA expressed preferentially in primary TCs, SV40-transformed TCs, primary lung cells, and SV40-transformed primary lung cells

Compared pairs

Up > 0

Up > 2

Up > 4

Down > 0

Down > 2

Down > 4

Purified TCsSV40 vs. non-purified primary lung TCs

77

3

0

579

16

2

Non-purified lung TCsSV40 vs. purified primary lung TCs

306

15

4

756

15

0

Non-purified lung TCsSV40 vs. non-purified primary lung TCs

114

7

2

607

20

0

Purified TCsSV40 vs. non-purified lung TCsSV40

7

0

0

41

4

1

Purified TCsSV40 vs. purified primary lung TCs

112

11

0

499

12

1

Purified primary lung TCs vs. non-purified primary lung TCs

0

0

0

13

2

1

Probe set ID

Fold change

p-value

Gene feature

(A) Genes up/down-regulated in SV40-transformed TCs compared with non-purified primary lung TCs

TC17000728.hg.1

− 3.568496

2.70E−05

Down

TC06001978.hg.1

− 2.084397

3.00E−05

Down

TC08000302.hg.1

− 1.909385

3.30E−05

Down

TC07001784.hg.1

− 1.941664

3.50E−05

Down

TC03003114.hg.1

2.957271

3.80E−05

Up

TC11002382.hg.1

− 5.521638

4.00E−05

Down

TC09000963.hg.1

− 2.006316

4.30E−05

Down

TC15000452.hg.1

− 2.008375

4.60E−05

Down

TC16001289.hg.1

− 1.75485

4.80E−05

Down

TC02000396.hg.1

− 1.817337

5.10E−05

Down

TC06000639.hg.1

− 2.1972

5.40E−05

Down

TC12000927.hg.1

− 2.098063

5.60E−05

Down

TC08002253.hg.1

− 3.102457

5.90E−05

Down

TC11001010.hg.1

− 1.660071

6.10E−05

Down

TC17001801.hg.1

− 2.429971

6.40E−05

Down

TC02001602.hg.1

− 1.575753

6.70E−05

Down

TC02001940.hg.1

− 1.965258

6.90E−05

Down

TC07000780.hg.1

− 2.054482

7.20E−05

Down

TC19000767.hg.1

− 1.795968

7.40E−05

Down

TC09001648.hg.1

− 2.05885

7.70E−05

Down

TC05001593.hg.1

− 1.786234

8.00E−05

Down

TC09000971.hg.1

− 1.864315

8.20E−05

Down

TC04000160.hg.1

− 1.653172

8.50E−05

Down

TC0X001624.hg.1

− 1.966802

8.70E−05

Down

TC10002919.hg.1

− 1.570089

9.00E−05

Down

TC03002042.hg.1

− 1.634325

9.30E−05

Down

TC08001415.hg.1

− 1.709011

9.50E−05

Down

TC02000336.hg.1

− 1.6597

9.80E−05

Down

TC01006068.hg.1

− 1.773582

0.000101

Down

TC11000967.hg.1

− 2.600896

0.000103

Down

TC20001277.hg.1

1.567066

0.000106

Up

TC19000951.hg.1

− 1.643102

0.000108

Down

TC05000152.hg.1

− 1.698079

0.000111

Down

TC12000188.hg.1

− 1.705076

0.000114

Down

TC02000205.hg.1

− 1.840391

0.000116

Down

TC02002456.hg.1

− 1.803182

0.000119

Down

TC06002006.hg.1

− 1.642511

0.000121

Down

TC01003510.hg.1

− 1.59482

0.000124

Down

TC08001864.hg.1

1.822

0.000127

Up

TC20000952.hg.1

− 1.813744

0.000129

Down

TC04002890.hg.1

1.584375

0.000132

Up

TC11002894.hg.1

1.642096

0.000135

Up

TC03001841.hg.1

− 1.694023

0.000137

Down

TC04001635.hg.1

− 2.085812

0.00014

Down

TC04002560.hg.1

2.11556

0.000142

Up

TC16001498.hg.1

1.522853

0.000145

Up

TC15001604.hg.1

− 1.523167

0.000148

Down

TC20000373.hg.1

− 1.641514

0.00015

Down

TC12000633.hg.1

− 1.690876

0.000153

Down

TC13000783.hg.1

− 2.460055

0.000155

Down

TC15001326.hg.1

− 1.512893

0.000158

Down

TC12001286.hg.1

− 1.794425

0.000161

Down

TC01005824.hg.1

− 1.623728

0.000163

Down

TC19001567.hg.1

1.574923

0.000166

Up

TC17001773.hg.1

− 1.52185

0.000168

Down

TC02004814.hg.1

− 1.610212

0.000171

Down

TC19000785.hg.1

− 1.687945

0.000174

Down

TC12000558.hg.1

− 1.462384

0.000176

Down

TC02003744.hg.1

1.609164

0.000179

Up

TC10000962.hg.1

− 1.497291

0.000182

Down

TC12000231.hg.1

− 1.45832

0.000184

Down

TC11003109.hg.1

2.194265

0.000187

Up

TC09001602.hg.1

− 1.532716

0.000189

Down

TC20000650.hg.1

− 1.709435

0.000192

Down

TC0X001292.hg.1

− 2.223119

0.000195

Down

TC17000491.hg.1

− 1.571049

0.000197

Down

TC02001836.hg.1

− 1.460727

2.00E−04

Down

TC02001799.hg.1

− 1.884772

0.000202

Down

TC11002486.hg.1

− 1.617606

0.000205

Down

TC05001562.hg.1

− 1.506318

0.000208

Down

TC19000163.hg.1

− 1.58983

0.00021

Down

TC03001571.hg.1

− 1.551407

0.000213

Down

TC01002801.hg.1

1.387205

0.000215

Up

TC10000791.hg.1

− 1.567348

0.000218

Down

TC05002279.hg.1

− 1.404635

0.000221

Down

TC14000620.hg.1

− 1.492016

0.000223

Down

TC21000698.hg.1

− 1.432959

0.000226

Down

TC0X001976.hg.1

1.511003

0.000229

Up

TC05003313.hg.1

1.520386

0.000231

Up

TC22000098.hg.1

− 1.597171

0.000234

Down

TC08000801.hg.1

− 1.529742

0.000236

Down

TC22000156.hg.1

1.691877

0.000239

Up

TC16002030.hg.1

− 1.399794

0.000242

Down

TC0X001158.hg.1

− 1.925543

0.000244

Down

TC06000041.hg.1

− 1.3817

0.000247

Down

TC10000866.hg.1

− 1.499786

0.000249

Down

TC03000195.hg.1

− 1.569494

0.000252

Down

TC01003308.hg.1

− 1.760166

0.000255

Down

TC01004112.hg.1

− 1.64911

0.000257

Down

TC0X001770.hg.1

− 1.818282

0.00026

Down

TC04000508.hg.1

− 1.514532

0.000262

Down

TC06000705.hg.1

− 1.536016

0.000265

Down

TC02003743.hg.1

1.526381

0.000268

Up

TC05002800.hg.1

− 1.561318

0.00027

Down

TC01005268.hg.1

1.82533

0.000273

Up

TC08000450.hg.1

− 1.626193

0.000276

Down

TC10000439.hg.1

− 1.447509

0.000278

Down

TC06004042.hg.1

− 1.43228

0.000281

Down

TC09002851.hg.1

− 1.367414

0.000283

Down

TC06001651.hg.1

− 1.434151

0.000286

Down

TC07003059.hg.1

1.731542

0.000289

Up

TC10000686.hg.1

− 1.370893

0.000291

Down

TC08000385.hg.1

− 1.537691

0.000294

Down

TC02001432.hg.1

− 1.513117

0.000296

Down

TC01002746.hg.1

− 1.610494

0.000299

Down

TC03002116.hg.1

− 1.353733

0.000302

Down

TC01005428.hg.1

1.560865

0.000304

Up

TC11003210.hg.1

1.443241

0.000307

Up

TC21000149.hg.1

− 1.397728

0.00031

Down

TC09001534.hg.1

− 1.579598

0.000312

Down

TC0X000450.hg.1

− 1.38553

0.000315

Down

TC0X001136.hg.1

− 1.386582

0.000317

Down

TC06002801.hg.1

− 1.504601

0.00032

Down

TC12002688.hg.1

− 1.609811

0.000323

Down

TC04002443.hg.1

− 1.520125

0.000325

Down

TC16001253.hg.1

− 1.436957

0.000328

Down

TC06002402.hg.1

1.593718

0.00033

Up

TC04001524.hg.1

− 1.497563

0.000333

Down

TC22001417.hg.1

− 1.526196

0.000336

Down

TC10001922.hg.1

1.256632

0.000338

Up

TC02003914.hg.1

− 1.445488

0.000341

Down

TC16000510.hg.1

− 1.576476

0.000343

Down

TC01002976.hg.1

− 1.493934

0.000346

Down

TC0M000020.hg.1

− 5.95641

0.000349

Down

TC01002798.hg.1

− 1.77144

0.000351

Down

TC01006074.hg.1

− 1.417269

0.000354

Down

TC06000568.hg.1

− 1.558205

0.000357

Down

TC12000088.hg.1

1.369654

0.000359

Up

TC16001359.hg.1

1.37628

0.000362

Up

TC03001321.hg.1

− 1.300817

0.000364

Down

TC07002531.hg.1

1.474871

0.000367

Up

TC0X000233.hg.1

− 1.387042

0.00037

Down

TC0X000985.hg.1

− 1.911084

0.000372

Down

TC0X001762.hg.1

− 1.495234

0.000375

Down

TC05000067.hg.1

1.605557

0.000377

Up

TC09001461.hg.1

− 1.504051

0.00038

Down

TC15000651.hg.1

− 1.579594

0.000383

Down

TC0X001889.hg.1

1.389217

0.000385

Up

TC15002609.hg.1

1.387993

0.000388

Up

TC14000925.hg.1

− 1.487896

0.00039

Down

TC22001175.hg.1

− 1.488885

0.000393

Down

TC04001945.hg.1

− 1.669152

0.000396

Down

TC09000096.hg.1

− 1.861195

0.000398

Down

TC05002818.hg.1

− 1.472401

0.000401

Down

TC07002463.hg.1

1.484579

0.000404

Up

TC01003990.hg.1

− 1.543233

0.000406

Down

TC06003126.hg.1

− 1.312105

0.000409

Down

TC12000805.hg.1

− 1.554705

0.000411

Down

TC17002196.hg.1

1.345657

0.000414

Up

TC04000811.hg.1

− 1.321197

0.000422

Down

TC22000646.hg.1

1.223546

0.000424

Up

TC11003382.hg.1

1.556575

0.000427

Up

TC15001184.hg.1

− 1.306114

0.00043

Down

TC01000388.hg.1

1.394364

0.000432

Up

TC03003257.hg.1

− 1.314749

0.000435

Down

TC08000285.hg.1

− 1.561996

0.000437

Down

TC0X001410.hg.1

− 1.54477

0.00044

Down

TC07000478.hg.1

− 1.522336

0.000443

Down

TC12002858.hg.1

1.359725

0.000448

Up

TC03001056.hg.1

− 1.423964

0.000451

Down

TC15001493.hg.1

− 1.264085

0.000456

Down

TC05001001.hg.1

− 1.366729

0.000458

Down

TC02001858.hg.1

− 1.336156

0.000461

Down

TC10002369.hg.1

1.416824

0.000464

Up

TC01002620.hg.1

− 1.372948

0.000466

Down

TC12001449.hg.1

− 1.559039

0.000477

Down

TC15002177.hg.1

1.204774

0.000479

Up

TC10001021.hg.1

− 1.351391

0.000482

Down

TC0X002006.hg.1

− 1.276702

0.000487

Down

TC0M000021.hg.1

− 1.76836

0.000492

Down

TC02001302.hg.1

− 1.500158

0.000498

Down

TC07000690.hg.1

− 1.464123

0.000505

Down

TC05000861.hg.1

− 1.43654

0.000508

Down

TC05003112.hg.1

− 1.883715

0.000511

Down

TC22000400.hg.1

− 1.397564

0.000513

Down

TC14001892.hg.1

− 1.409308

0.000516

Down

TC11002784.hg.1

1.463689

0.000518

Up

TC0X001907.hg.1

1.631743

0.000526

Up

TC0X001411.hg.1

− 1.575078

0.000529

Down

TC06000972.hg.1

− 1.412607

0.000532

Down

TC07000702.hg.1

− 1.574012

0.000534

Down

TC15001073.hg.1

− 1.487709

0.000537

Down

TC08002416.hg.1

− 1.30562

0.000539

Down

TC05000611.hg.1

− 1.342755

0.000542

Down

TC09001256.hg.1

− 1.245674

0.000545

Down

TC0M000023.hg.1

− 1.665398

0.000552

Down

TC16001522.hg.1

− 1.550585

0.000555

Down

TC02001429.hg.1

− 1.384528

0.000558

Down

TC05000688.hg.1

− 1.465004

0.00056

Down

TC07001655.hg.1

− 1.483501

0.000563

Down

TC09002148.hg.1

− 1.294238

0.000565

Down

TC03002425.hg.1

− 1.414502

0.000568

Down

TC17002307.hg.1

1.574493

0.000571

Up

TC11002476.hg.1

− 1.407878

0.000573

Down

TC07002321.hg.1

1.340462

0.000576

Up

TC10001073.hg.1

1.420479

0.000579

Up

TC13001025.hg.1

1.281803

0.000581

Up

TC18000050.hg.1

− 1.43278

0.000586

Down

TC08001833.hg.1

1.301019

0.000589

Up

TC02001366.hg.1

− 1.411719

0.000594

Down

TC09002445.hg.1

− 1.365813

0.000597

Down

TC12000244.hg.1

− 1.456782

0.000599

Down

TC16000919.hg.1

− 1.412488

0.000602

Down

TC01001291.hg.1

1.30011

0.000605

Up

TC04002772.hg.1

− 1.318518

0.000607

Down

TC09001898.hg.1

− 1.355328

0.00061

Down

TC02000784.hg.1

1.244517

0.000612

Up

TC0X001210.hg.1

− 1.297482

0.000615

Down

TC03001672.hg.1

− 1.300852

0.00062

Down

TC16001991.hg.1

− 1.312834

0.000623

Down

TC20001376.hg.1

1.259521

0.000626

Up

TC12001995.hg.1

− 1.534637

0.000631

Down

TC20001199.hg.1

− 1.438895

0.000633

Down

TC07001788.hg.1

− 1.605406

0.000639

Down

TC08001734.hg.1

− 1.313819

0.000641

Down

TC07001706.hg.1

− 1.621814

0.000645

Down

TC07001709.hg.1

− 1.621814

0.000645

Down

TC03002939.hg.1

1.465012

0.000649

Up

TC11000808.hg.1

− 1.255062

0.000652

Down

TC02002028.hg.1

− 1.408438

0.000654

Down

TC02002581.hg.1

− 1.345698

0.000657

Down

TC01005437.hg.1

− 1.25784

0.000659

Down

TC18000864.hg.1

1.420831

0.000662

Up

TC03003057.hg.1

1.297577

0.000667

Up

TC11002077.hg.1

− 1.516075

0.00067

Down

TC0X001618.hg.1

− 1.55017

0.000673

Down

TC16002013.hg.1

− 1.464825

0.000675

Down

TC02002957.hg.1

− 1.21553

0.000678

Down

TC14001601.hg.1

− 1.266846

0.00068

Down

TC06003365.hg.1

1.258709

0.000683

Up

TC02001623.hg.1

− 1.387294

0.000691

Down

TC0X001430.hg.1

− 1.517692

0.000693

Down

TC02001248.hg.1

− 1.343015

0.000701

Down

TC07000139.hg.1

− 1.548066

0.000704

Down

TC08001239.hg.1

− 1.411515

0.000709

Down

TC16001996.hg.1

− 1.32531

0.000714

Down

TC07001848.hg.1

− 1.223116

0.000717

Down

TC17001317.hg.1

− 1.258521

0.00072

Down

TC06001365.hg.1

− 1.568292

0.000722

Down

TC09000783.hg.1

− 1.241694

0.000725

Down

TC03003056.hg.1

1.309714

0.000727

Up

TC11001141.hg.1

− 1.474463

0.00073

Down

TC15000819.hg.1

− 1.466781

0.000733

Down

TC17000164.hg.1

− 1.381715

0.000743

Down

TC10002136.hg.1

− 1.222626

0.000748

Down

TC12000238.hg.1

− 1.398297

0.000751

Down

TC19002149.hg.1

1.274434

0.000754

Up

TC10001432.hg.1

− 1.395271

0.000756

Down

TC12002396.hg.1

1.37332

0.000759

Up

TC06002303.hg.1

− 1.481066

0.000767

Down

TC02002233.hg.1

1.281339

0.000769

Up

TC05002034.hg.1

− 1.450196

0.000772

Down

TC03002972.hg.1

− 1.372256

0.000777

Down

TC02001721.hg.1

− 1.367369

0.00078

Down

TC05001948.hg.1

− 1.229624

0.000782

Down

TC06003416.hg.1

− 1.25784

0.000785

Down

TC05000214.hg.1

− 1.345182

0.000787

Down

TC0X002258.hg.1

− 1.40134

0.000795

Down

TC13001479.hg.1

1.612735

0.000798

Up

TC01004166.hg.1

− 1.350561

0.000803

Down

TC15000333.hg.1

1.346913

0.000806

Up

TC18000381.hg.1

− 1.459511

0.000808

Down

TC0X001739.hg.1

− 1.221974

0.000821

Down

TC04000854.hg.1

− 1.342571

0.000824

Down

TC14001245.hg.1

− 1.363644

0.000827

Down

TC16000853.hg.1

− 1.526047

0.000829

Down

TC02004957.hg.1

− 1.256608

0.000832

Down

TC16000648.hg.1

− 1.967375

0.000834

Down

TC01002757.hg.1

− 1.315911

0.000837

Down

TC05000183.hg.1

− 1.466612

0.000842

Down

TC08000652.hg.1

− 1.444517

0.000845

Down

TC12003194.hg.1

− 1.396169

0.00085

Down

TC01002633.hg.1

− 1.459449

0.000853

Down

TC02004273.hg.1

− 1.239977

0.000855

Down

TC0X000473.hg.1

− 1.208647

0.000863

Down

TC01001013.hg.1

1.402441

0.000866

Up

TC07003162.hg.1

− 1.286344

0.000871

Down

TC20000340.hg.1

− 1.467848

0.000874

Down

TC02000955.hg.1

− 1.516537

0.000876

Down

TC17001429.hg.1

− 1.288095

0.000884

Down

TC02002970.hg.1

− 1.262033

0.000887

Down

TC19000423.hg.1

− 1.270008

0.000892

Down

TC04002642.hg.1

− 1.379802

0.000895

Down

TC14000739.hg.1

1.321768

0.000902

Up

TC09001812.hg.1

− 1.231765

0.000905

Down

TC15001577.hg.1

− 1.461504

0.000908

Down

TC12003053.hg.1

1.319866

0.00091

Up

TC12002444.hg.1

1.329822

0.000913

Up

TC07001462.hg.1

1.464142

0.000915

Up

TC12001455.hg.1

− 1.443029

0.000918

Down

TC04000571.hg.1

− 1.489108

0.000921

Down

TC0X001193.hg.1

1.282141

0.000923

Up

TC17002577.hg.1

− 1.222474

0.000929

Down

TC0X000986.hg.1

− 1.537172

0.000934

Down

TC18000372.hg.1

1.306631

0.000936

Up

TC12003159.hg.1

− 1.26419

0.000944

Down

TC12001777.hg.1

− 1.387482

0.000947

Down

TC17000629.hg.1

1.506256

0.000952

Up

TC01002397.hg.1

− 1.298179

0.000955

Down

TC11000089.hg.1

− 1.293079

0.00096

Down

TC19001173.hg.1

− 1.788733

0.000962

Down

TC07002196.hg.1

− 1.237867

0.000965

Down

TC01004898.hg.1

1.21174

0.000968

Up

TC15002247.hg.1

1.224493

0.000976

Up

TC05001142.hg.1

− 1.326114

0.000978

Down

TC05000621.hg.1

− 1.464508

0.000989

Down

TC09000642.hg.1

− 1.540151

0.000991

Down

TC09001936.hg.1

− 1.364479

0.000994

Down

TC17002761.hg.1

− 1.269107

0.000999

Down

TC04002187.hg.1

1.408721

0.001002

Up

TC02003570.hg.1

− 1.280663

0.001004

Down

TC0X001616.hg.1

− 1.322208

0.001007

Down

TC09001972.hg.1

− 1.209848

0.001012

Down

TC06003710.hg.1

− 1.497029

0.001015

Down

TC03001944.hg.1

1.214647

0.001017

Up

TC01004109.hg.1

− 1.321069

0.00102

Down

TC17002195.hg.1

1.21302

0.001023

Up

TC05002180.hg.1

− 1.221883

0.001036

Down

TC20001446.hg.1

1.296941

0.001038

Up

TC09002470.hg.1

1.352053

0.001041

Up

TC08001621.hg.1

− 1.246738

0.001043

Down

TC02004746.hg.1

1.298033

0.001046

Up

TC10000082.hg.1

− 1.243931

0.001051

Down

TC08001847.hg.1

1.362437

0.001056

Up

TC10002381.hg.1

− 1.21549

0.001062

Down

TC14001177.hg.1

− 1.270448

0.001064

Down

TC10000872.hg.1

− 1.230721

0.00107

Down

TC06000025.hg.1

1.328452

0.001075

Up

TC01005249.hg.1

− 1.213079

0.001083

Down

TC16001555.hg.1

− 1.208988

0.00109

Down

TC0Y000124.hg.1

1.246549

0.001093

Up

TC11001732.hg.1

− 1.318377

0.001096

Down

TC03000629.hg.1

− 1.439342

0.001098

Down

TC09001843.hg.1

− 1.204212

0.001104

Down

TC09002783.hg.1

− 1.269006

0.001106

Down

TC01004933.hg.1

1.342382

0.001109

Up

TC10000236.hg.1

− 1.319501

0.001114

Down

TC05001371.hg.1

− 1.314131

0.001122

Down

TC14000052.hg.1

− 1.409573

0.001124

Down

TC21000931.hg.1

− 1.264853

0.00113

Down

TC03002997.hg.1

1.270405

0.001132

Up

TC05003198.hg.1

− 1.253982

0.001135

Down

TC02002711.hg.1

− 1.272432

0.001137

Down

TC02004784.hg.1

− 1.200546

0.001143

Down

TC05002575.hg.1

1.219313

0.001145

Up

TC01002594.hg.1

− 1.421401

0.001148

Down

TC16001826.hg.1

− 1.353943

0.001169

Down

TC08001640.hg.1

− 1.376088

0.001171

Down

TC17002837.hg.1

− 1.262026

0.001174

Down

TC08001247.hg.1

− 1.233191

0.001177

Down

TC07000624.hg.1

− 1.263829

0.001179

Down

TC12001263.hg.1

− 1.216333

0.001184

Down

TC06000824.hg.1

− 1.41643

0.00119

Down

TC12000184.hg.1

− 1.273853

0.001192

Down

TC12003089.hg.1

− 1.237444

0.001208

Down

TC10000369.hg.1

− 1.232303

0.001218

Down

TC03000823.hg.1

− 1.318296

0.001231

Down

TC0X000808.hg.1

− 1.294835

0.001237

Down

TC15001473.hg.1

− 1.390182

0.001239

Down

TC01006043.hg.1

− 1.279341

0.001242

Down

TC16001156.hg.1

− 1.347061

0.001245

Down

TC05000708.hg.1

− 1.457383

0.001247

Down

TC07002757.hg.1

− 1.342035

0.00125

Down

TC01003748.hg.1

− 1.247279

0.001252

Down

TC20000045.hg.1

− 1.611347

0.001255

Down

TC19000349.hg.1

− 1.294863

0.001258

Down

TC08002335.hg.1

− 1.575981

0.001273

Down

TC02003970.hg.1

− 1.261765

0.001276

Down

TC07002353.hg.1

− 1.21386

0.001292

Down

TC03000155.hg.1

− 1.308938

0.001294

Down

TC0X002344.hg.1

− 1.336301

0.001299

Down

TC01004110.hg.1

− 1.549747

0.00131

Down

TC12000390.hg.1

− 1.251394

0.001318

Down

TC14000427.hg.1

− 1.249078

0.001323

Down

TC03000342.hg.1

− 1.293203

0.001326

Down

TC09001279.hg.1

− 1.291408

0.001331

Down

TC14000693.hg.1

− 1.497742

0.001344

Down

TC12003094.hg.1

− 1.417707

0.001349

Down

TC06002606.hg.1

− 1.537348

0.001352

Down

TC06001540.hg.1

− 1.242118

0.001354

Down

TC03001808.hg.1

− 1.327132

0.001359

Down

TC10000793.hg.1

− 1.384112

0.001362

Down

TC20001166.hg.1

− 1.216393

0.001383

Down

TC01005264.hg.1

− 1.316901

0.001388

Down

TC09000471.hg.1

− 1.31262

0.001404

Down

TC19002342.hg.1

− 1.360527

0.00142

Down

TC0X001450.hg.1

− 1.226402

0.001433

Down

TC0X001094.hg.1

− 1.281421

0.001448

Down

TC0X000282.hg.1

− 1.397268

0.001451

Down

TC16001699.hg.1

− 1.21053

0.001459

Down

TC08000411.hg.1

− 1.264325

0.001477

Down

TC01003906.hg.1

− 1.277746

0.001485

Down

TC02001952.hg.1

− 1.202124

0.001487

Down

TC03002704.hg.1

− 1.2066

0.00149

Down

TC06002227.hg.1

− 1.536921

0.001493

Down

TC16000560.hg.1

− 1.319732

0.001501

Down

TC0X001939.hg.1

− 1.239263

0.001503

Down

TC11002900.hg.1

− 1.422263

0.001506

Down

TC09000516.hg.1

− 1.3743

0.001521

Down

TC20000564.hg.1

− 1.259432

0.001529

Down

TC08000425.hg.1

− 1.222783

0.001532

Down

TC07000862.hg.1

− 1.318867

0.001534

Down

TC12001821.hg.1

− 1.267134

0.001545

Down

TC11000653.hg.1

− 1.256931

0.001548

Down

TC02004514.hg.1

− 1.278303

0.00155

Down

TC05002588.hg.1

− 1.361963

0.001553

Down

TC06002096.hg.1

− 1.234314

0.001561

Down

TC10001912.hg.1

− 1.30431

0.001563

Down

TC02000188.hg.1

− 1.343934

0.001566

Down

TC03000381.hg.1

− 1.236027

0.0016

Down

TC20000763.hg.1

− 1.225856

0.001602

Down

TC19000786.hg.1

− 1.255489

0.001608

Down

TC08000224.hg.1

− 1.273889

0.00161

Down

TC12001052.hg.1

− 1.452174

0.001613

Down

TC07000779.hg.1

− 1.324442

0.001644

Down

TC12002368.hg.1

− 1.228785

0.001647

Down

TC02001190.hg.1

− 1.338948

0.001652

Down

TC05000526.hg.1

− 1.221816

0.001665

Down

TC04002294.hg.1

− 1.301327

0.001668

Down

TC21000706.hg.1

− 1.298316

0.001686

Down

TC02002768.hg.1

− 1.312801

0.001694

Down

TC17001656.hg.1

− 1.267211

0.001702

Down

TC03001494.hg.1

− 1.366098

0.00172

Down

TC13000481.hg.1

− 1.28573

0.001723

Down

TC16000776.hg.1

− 1.273221

0.001725

Down

TC10002723.hg.1

− 1.376529

0.001728

Down

TC10002728.hg.1

− 1.244225

0.001733

Down

TC01006051.hg.1

− 1.250802

0.001736

Down

TC05001849.hg.1

− 1.217863

0.001743

Down

TC10000232.hg.1

− 1.310615

0.001751

Down

TC01003920.hg.1

− 1.223489

0.001779

Down

TC01003921.hg.1

− 1.223489

0.001779

Down

TC01003922.hg.1

− 1.223489

0.001779

Down

TC01003923.hg.1

− 1.223489

0.001779

Down

TC01003924.hg.1

− 1.223489

0.001779

Down

TC01003925.hg.1

− 1.223489

0.001779

Down

TC01003926.hg.1

− 1.223489

0.001779

Down

TC01003927.hg.1

− 1.223489

0.001779

Down

TC01003929.hg.1

− 1.223489

0.001779

Down

TC01003930.hg.1

− 1.223489

0.001779

Down

TC01003931.hg.1

− 1.223489

0.001779

Down

TC01003932.hg.1

− 1.223489

0.001779

Down

TC01003933.hg.1

− 1.223489

0.001779

Down

TC01003934.hg.1

− 1.223489

0.001779

Down

TC01003935.hg.1

− 1.223489

0.001779

Down

TC01003936.hg.1

− 1.223489

0.001779

Down

TC03003030.hg.1

− 1.478844

0.001803

Down

TC14000845.hg.1

− 1.312238

0.001806

Down

TC05002975.hg.1

− 1.285007

0.001809

Down

TC20000261.hg.1

− 1.329768

0.001817

Down

TC14001281.hg.1

− 1.272863

0.001819

Down

TC05000998.hg.1

− 1.275857

0.00183

Down

TC13001120.hg.1

− 1.345262

0.001832

Down

TC03000057.hg.1

− 1.226194

0.001853

Down

TC11000768.hg.1

− 1.347505

0.001856

Down

TC04001473.hg.1

− 1.385031

0.001861

Down

TC08001306.hg.1

− 1.237854

0.001864

Down

TC02004490.hg.1

− 1.228885

0.001866

Down

TC02004794.hg.1

− 1.244544

0.001877

Down

TC08001540.hg.1

− 1.312764

0.001884

Down

TC03000875.hg.1

− 1.363667

0.001898

Down

TC06001064.hg.1

− 1.411292

0.001903

Down

TC08000407.hg.1

− 1.291451

0.001905

Down

TC10002820.hg.1

− 1.233983

0.001908

Down

TC14000661.hg.1

− 1.226019

0.001937

Down

TC19000244.hg.1

− 1.222774

0.001939

Down

TC09000897.hg.1

− 1.241196

0.001952

Down

TC11002142.hg.1

− 1.530933

0.001978

Down

TC04000338.hg.1

− 1.28848

0.001984

Down

TC12002736.hg.1

− 1.306143

0.001989

Down

TC09000458.hg.1

− 1.260067

0.002005

Down

TC19002478.hg.1

− 1.251909

0.002012

Down

TC17000607.hg.1

− 1.376805

0.00202

Down

TC08002174.hg.1

− 1.252071

0.002049

Down

TC15002522.hg.1

− 1.352134

0.002059

Down

TC07001721.hg.1

− 1.27015

0.002099

Down

TC11000172.hg.1

− 1.297266

0.002101

Down

TC0M000022.hg.1

− 1.790883

0.002127

Down

TC01000642.hg.1

− 1.273087

0.002135

Down

TC04002779.hg.1

− 1.295919

0.002172

Down

TC17000230.hg.1

− 1.28801

0.002177

Down

TC10002673.hg.1

− 1.341757

0.002185

Down

TC02000761.hg.1

− 1.200639

0.00219

Down

TC07001870.hg.1

− 1.503979

0.002198

Down

TC13001485.hg.1

− 1.322513

0.0022

Down

TC0X002104.hg.1

− 1.235461

0.002203

Down

TC01003794.hg.1

− 1.275671

0.002216

Down

TC14000809.hg.1

− 1.232224

0.002247

Down

TC08001563.hg.1

− 1.281014

0.002292

Down

TC02003041.hg.1

− 1.439696

0.002305

Down

TC01000878.hg.1

− 1.200347

0.002313

Down

TC16001204.hg.1

− 1.216715

0.002315

Down

TC10001355.hg.1

− 1.266825

0.002318

Down

TC10001940.hg.1

− 1.302501

0.002334

Down

TC04000456.hg.1

− 1.259762

0.002347

Down

TC19001288.hg.1

− 1.211289

0.002355

Down

TC21000403.hg.1

− 1.262158

0.002365

Down

TC15001614.hg.1

− 1.242348

0.00237

Down

TC01002339.hg.1

− 1.287548

0.002373

Down

TC21000126.hg.1

− 1.220964

0.002375

Down

TC04001229.hg.1

− 1.226388

0.002399

Down

TC10002579.hg.1

− 1.204095

0.002422

Down

TC01003671.hg.1

− 1.209995

0.00243

Down

TC01001982.hg.1

− 1.217144

0.002436

Down

TC15001480.hg.1

− 1.259755

0.002438

Down

TC22001201.hg.1

− 1.534217

0.002443

Down

TC10000404.hg.1

− 1.319697

0.002472

Down

TC01000565.hg.1

− 1.208333

0.002493

Down

TC11001288.hg.1

− 1.381912

0.002496

Down

TC08001096.hg.1

− 1.310737

0.002532

Down

TC17001148.hg.1

− 1.273032

0.002535

Down

TC22001301.hg.1

− 1.306173

0.002566

Down

TC04002309.hg.1

− 1.209813

0.002595

Down

TC21000144.hg.1

− 1.230499

0.0026

Down

TC20000800.hg.1

− 1.228074

0.002613

Down

TC10001508.hg.1

− 1.242578

0.002629

Down

TC11001429.hg.1

− 1.21474

0.002699

Down

TC10001326.hg.1

− 1.260137

0.002712

Down

TC16001788.hg.1

− 1.266336

0.00272

Down

TC01000718.hg.1

− 1.246934

0.002731

Down

TC02004391.hg.1

− 1.248587

0.002752

Down

TC02004870.hg.1

− 1.393997

0.002775

Down

TC02004787.hg.1

− 1.417426

0.002791

Down

TC12000361.hg.1

− 1.251152

0.002793

Down

TC15000227.hg.1

− 1.256604

0.002806

Down

TC01001745.hg.1

− 1.285385

0.002814

Down

TC05002924.hg.1

− 1.252245

0.002817

Down

TC07002052.hg.1

− 1.237299

0.00283

Down

TC03002295.hg.1

− 1.273649

0.002848

Down

TC06001529.hg.1

− 1.485667

0.002863

Down

TC6_apd_hap1000080.hg.1

− 1.485667

0.002863

Down

TC6_cox_hap2000158.hg.1

− 1.485667

0.002863

Down

TC6_dbb_hap3000147.hg.1

− 1.485667

0.002863

Down

TC6_mann_hap4000135.hg.1

− 1.485667

0.002863

Down

TC6_mcf_hap5000135.hg.1

− 1.485667

0.002863

Down

TC6_qbl_hap6000150.hg.1

− 1.485667

0.002863

Down

TC6_ssto_hap7000130.hg.1

− 1.485667

0.002863

Down

TC07002428.hg.1

− 1.377767

0.002882

Down

TC08000954.hg.1

− 1.303647

0.002911

Down

TC06002505.hg.1

− 1.254488

0.002927

Down

TC21000447.hg.1

− 1.250815

0.002953

Down

TC17001238.hg.1

− 1.230333

0.002955

Down

TC15002586.hg.1

− 1.305785

0.002963

Down

TC12000249.hg.1

− 1.225331

0.002976

Down

TC11002394.hg.1

− 1.214327

0.002989

Down

TC01005988.hg.1

− 1.33252

0.003005

Down

TC21000081.hg.1

− 1.227667

0.003015

Down

TC08000521.hg.1

− 1.204106

0.003023

Down

TC09000907.hg.1

− 1.244625

0.003026

Down

TC14000688.hg.1

− 1.223768

0.003062

Down

TC03000666.hg.1

− 1.298135

0.003065

Down

TC09000250.hg.1

− 1.206244

0.003078

Down

TC01004185.hg.1

− 1.401887

0.003086

Down

TC15002417.hg.1

− 1.211724

0.003089

Down

TC06003509.hg.1

− 1.227037

0.003094

Down

TC01004296.hg.1

− 1.218277

0.003143

Down

TC16000068.hg.1

− 1.254429

0.003169

Down

TC01002874.hg.1

− 1.282112

0.003198

Down

TC03000249.hg.1

− 1.287577

0.003209

Down

TC16001224.hg.1

− 1.33179

0.003219

Down

TC21000483.hg.1

− 1.416389

0.003224

Down

TC14001345.hg.1

− 1.283492

0.003237

Down

TC16001268.hg.1

− 1.22617

0.003256

Down

TC02004413.hg.1

− 1.215328

0.003269

Down

TC02001762.hg.1

− 1.263185

0.003271

Down

TC18000587.hg.1

− 1.230616

0.003274

Down

TC10001008.hg.1

− 1.241843

0.003295

Down

TC0Y000340.hg.1

− 1.250366

0.003297

Down

TC13000269.hg.1

− 1.260255

0.0033

Down

TC20000841.hg.1

− 1.232297

0.003318

Down

TC14001908.hg.1

− 1.215891

0.003324

Down

TC19000842.hg.1

− 1.258765

0.003358

Down

TC04000223.hg.1

− 1.241108

0.00336

Down

TC21000697.hg.1

− 1.303591

0.003394

Down

TC19000162.hg.1

− 1.200106

0.003397

Down

TC10000985.hg.1

− 1.215571

0.003402

Down

TC17001640.hg.1

− 1.212141

0.003405

Down

TC05000237.hg.1

− 1.373017

0.003431

Down

TC09000041.hg.1

− 1.214059

0.003441

Down

TC14002178.hg.1

− 1.230783

0.003446

Down

TC05002490.hg.1

− 1.232531

0.003465

Down

TC15002624.hg.1

− 1.272763

0.003483

Down

TC02002012.hg.1

− 1.316727

0.003499

Down

TC09000159.hg.1

− 1.390197

0.003533

Down

TC09001661.hg.1

− 1.227836

0.003577

Down

TC10001055.hg.1

− 1.228079

0.003624

Down

TC08001514.hg.1

− 1.277552

0.003629

Down

TC11000282.hg.1

− 1.329442

0.003642

Down

TC05000068.hg.1

− 1.350724

0.003645

Down

TC11001479.hg.1

− 1.279519

0.003647

Down

TC18000287.hg.1

− 1.200612

0.003655

Down

TC0X000232.hg.1

− 1.202026

0.003658

Down

TC01002467.hg.1

− 1.339589

0.003689

Down

TC01005508.hg.1

− 1.233888

0.003692

Down

TC02000635.hg.1

− 1.204559

0.003708

Down

TC05002063.hg.1

− 1.245733

0.003747

Down

TC0X002282.hg.1

− 1.216687

0.003788

Down

TC06001847.hg.1

− 1.202026

0.003791

Down

TC05003245.hg.1

− 1.245568

0.003825

Down

TC15002600.hg.1

− 1.202092

0.003846

Down

TC05001212.hg.1

− 1.356607

0.003867

Down

TC14001340.hg.1

− 1.246169

0.003903

Down

TC16002021.hg.1

− 1.243627

0.003914

Down

TC19000560.hg.1

− 1.215974

0.003922

Down

TC10000041.hg.1

− 1.253239

0.003961

Down

TC03002003.hg.1

− 1.293355

0.003977

Down

TC01003999.hg.1

− 1.213308

0.004016

Down

TC11003279.hg.1

− 1.239214

0.004073

Down

TC12000588.hg.1

− 1.255784

0.004105

Down

TC03001070.hg.1

− 1.236896

0.004107

Down

TC05000876.hg.1

− 1.344018

0.004112

Down

TC16001209.hg.1

− 1.206352

0.004131

Down

TC22000194.hg.1

− 1.201822

0.004141

Down

TC01000906.hg.1

− 1.237207

0.004146

Down

TC09001410.hg.1

− 1.328568

0.004149

Down

TC15002068.hg.1

− 1.261482

0.004152

Down

TC13000345.hg.1

− 1.211536

0.004193

Down

TC03002998.hg.1

− 1.271102

0.004199

Down

TC03002746.hg.1

− 1.217988

0.004201

Down

TC15000264.hg.1

− 1.253176

0.004219

Down

TC13000676.hg.1

− 1.259466

0.004222

Down

TC13001035.hg.1

− 1.299097

0.00423

Down

TC01000516.hg.1

− 1.415817

0.004238

Down

TC11002367.hg.1

− 1.203564

0.004256

Down

TC09001709.hg.1

− 1.365244

0.004261

Down

TC10001951.hg.1

− 1.254194

0.004269

Down

TC01005957.hg.1

− 1.276394

0.00429

Down

TC21000155.hg.1

− 1.253291

0.004303

Down

TC08001116.hg.1

− 1.261791

0.004358

Down

TC17002050.hg.1

− 1.21877

0.004384

Down

TC11001973.hg.1

− 1.210002

0.004426

Down

TC10001296.hg.1

− 1.200871

0.004441

Down

TC14000289.hg.1

− 1.311616

0.004481

Down

TC12000607.hg.1

− 1.30518

0.004488

Down

TC05002808.hg.1

− 1.219978

0.004507

Down

TC12001404.hg.1

− 1.256127

0.004509

Down

TC22001312.hg.1

− 1.204404

0.004515

Down

TC13000501.hg.1

− 1.213954

0.004517

Down

TC19001712.hg.1

− 1.212198

0.004546

Down

TC05001815.hg.1

− 1.239784

0.004569

Down

TC0X000283.hg.1

− 1.229291

0.004585

Down

TC08001986.hg.1

− 1.281049

0.004588

Down

TC14000798.hg.1

− 1.441811

0.004598

Down

TC16001481.hg.1

− 1.228168

0.004619

Down

TC0X002079.hg.1

− 1.246788

0.004622

Down

TC17000557.hg.1

− 1.302083

0.004624

Down

TC04002474.hg.1

− 1.274389

0.004635

Down

TC17001193.hg.1

− 1.233444

0.004648

Down

TC01000331.hg.1

− 1.248432

0.004663

Down

TC11002966.hg.1

− 1.259327

0.004695

Down

TC06002589.hg.1

− 1.216984

0.004713

Down

TC06002011.hg.1

− 1.434725

0.004731

Down

TC0X000412.hg.1

− 1.250337

0.004744

Down

TC14001352.hg.1

− 1.286012

0.004755

Down

TC18000425.hg.1

− 1.208537

0.004757

Down

TC16002106.hg.1

− 1.246345

0.004784

Down

Probe set ID

Fold change

p-value

Gene feature

(B) Genes up/down-regulated in non-purified lung TCsSV40 compared with purified primary lung TCs

TC07002463.hg.1

2.512854

2.70E−05

Up

TC0M000020.hg.1

5.689014

3.00E−05

Up

TC03003114.hg.1

4.799932

3.20E−05

Up

TC16000648.hg.1

− 2.174193

3.50E−05

Down

TC17001801.hg.1

− 2.453481

3.80E−05

Down

TC02003744.hg.1

1.994216

4.00E−05

Up

TC11002894.hg.1

4.163733

4.30E−05

Up

TC11003109.hg.1

5.91745

4.50E−05

Up

TC20000952.hg.1

− 2.038322

4.80E−05

Down

TC12001286.hg.1

− 1.75483

5.10E−05

Down

TC09000971.hg.1

− 1.873134

5.30E−05

Down

TC02002456.hg.1

− 1.779116

5.60E−05

Down

TC04002560.hg.1

2.777915

5.80E−05

Up

TC05003313.hg.1

2.480494

6.10E−05

Up

TC02000205.hg.1

− 1.822189

6.40E−05

Down

TC08002510.hg.1

2.45585

6.60E−05

Up

TC20000045.hg.1

− 2.011887

6.90E−05

Down

TC12000927.hg.1

− 2.097234

7.10E−05

Down

TC09001648.hg.1

− 1.962423

7.40E−05

Down

TC0X000985.hg.1

− 2.143818

7.70E−05

Down

TC01003308.hg.1

− 1.928676

7.90E−05

Down

TC22000156.hg.1

1.958661

8.20E−05

Up

TC04001945.hg.1

− 2.062837

8.40E−05

Down

TC06000639.hg.1

− 2.085546

8.70E−05

Down

TC06001978.hg.1

− 1.915437

9.00E−05

Down

TC15000452.hg.1

− 1.936021

9.20E−05

Down

TC02001940.hg.1

− 1.951298

9.50E−05

Down

TC06000568.hg.1

− 1.714082

9.70E−05

Down

TC08000302.hg.1

− 1.960068

1.00E−04

Down

TC17002479.hg.1

1.736394

0.000102

Up

TC04002890.hg.1

2.211564

0.000105

Up

TC20000650.hg.1

− 1.762113

0.000108

Down

TC02004814.hg.1

− 1.74863

0.00011

Down

TC17001773.hg.1

− 1.57464

0.000113

Down

TC07001784.hg.1

− 1.815099

0.000115

Down

TC05001593.hg.1

− 1.890235

0.000118

Down

TC0X001889.hg.1

1.807993

0.000121

Up

TC11002382.hg.1

− 2.886542

0.000123

Down

TC0M000022.hg.1

2.047915

0.000126

Up

TC06004042.hg.1

− 1.606168

0.000128

Down

TC12001449.hg.1

− 1.770781

0.000131

Down

TC09000096.hg.1

− 1.882465

0.000134

Down

TC0X001824.hg.1

1.668798

0.000136

Up

TC08000801.hg.1

− 1.742013

0.000139

Down

TC01005811.hg.1

1.59682

0.000141

Up

TC0X001410.hg.1

− 1.540303

0.000144

Down

TC13000783.hg.1

− 2.094361

0.000147

Down

TC0X001411.hg.1

− 1.589254

0.000149

Down

TC07000702.hg.1

− 1.788577

0.000152

Down

TC07002531.hg.1

1.762967

0.000154

Up

TC20000373.hg.1

− 1.578384

0.000157

Down

TC06002402.hg.1

1.778454

0.00016

Up

TC09001483.hg.1

1.350997

0.000162

Up

TC07001655.hg.1

− 1.528388

0.000165

Down

TC01004012.hg.1

1.503918

0.000167

Up

TC0X001136.hg.1

− 1.534991

0.00017

Down

TC01002339.hg.1

− 1.538502

0.000173

Down

TC12000633.hg.1

− 1.841917

0.000175

Down

TC02001602.hg.1

− 1.669996

0.000178

Down

TC16001991.hg.1

− 1.351113

0.00018

Down

TC03001841.hg.1

− 1.638782

0.000183

Down

TC22001175.hg.1

− 1.558447

0.000186

Down

TC14001892.hg.1

− 1.603015

0.000188

Down

TC08002500.hg.1

− 1.406478

0.000191

Down

TC02004615.hg.1

1.498343

0.000193

Up

TC12000231.hg.1

− 1.476476

0.000196

Down

TC14000711.hg.1

− 1.357936

0.000198

Down

TC16001289.hg.1

− 1.683139

0.000201

Down

TC0X001822.hg.1

1.466789

0.000204

Up

TC02000396.hg.1

− 1.782594

0.000206

Down

TC15002247.hg.1

1.443916

0.000209

Up

TC10000686.hg.1

− 1.508486

0.000211

Down

TC22000400.hg.1

− 1.524343

0.000214

Down

TC06003416.hg.1

− 1.409684

0.000217

Down

TC16002030.hg.1

− 1.497175

0.000219

Down

TC01002976.hg.1

− 1.555849

0.000222

Down

TC15001326.hg.1

− 1.510761

0.000224

Down

TC07002052.hg.1

− 1.585855

0.000227

Down

TC12001995.hg.1

− 1.471839

0.00023

Down

TC19000163.hg.1

− 1.563519

0.000232

Down

TC21000931.hg.1

− 1.527689

0.000235

Down

TC02003743.hg.1

1.519001

0.000237

Up

TC10000866.hg.1

− 1.606186

0.00024

Down

TC04002346.hg.1

1.48682

0.000243

Up

TC08001887.hg.1

1.336453

0.000245

Up

TC06001651.hg.1

− 1.472924

0.000248

Down

TC04000811.hg.1

− 1.415531

0.00025

Down

TC0X000279.hg.1

− 1.52073

0.000253

Down

TC04001635.hg.1

− 2.149662

0.000256

Down

TC19000767.hg.1

− 1.792384

0.000258

Down

TC04000160.hg.1

− 1.443667

0.000261

Down

TC16001498.hg.1

1.716487

0.000263

Up

TC04001524.hg.1

− 1.497583

0.000266

Down

TC01002798.hg.1

− 1.728642

0.000269

Down

TC04002187.hg.1

1.535246

0.000271

Up

TC05002063.hg.1

− 1.378512

0.000274

Down

TC09002847.hg.1

− 1.569396

0.000276

Down

TC05002818.hg.1

− 1.548005

0.000279

Down

TC0X001292.hg.1

− 2.249923

0.000282

Down

TC0X000450.hg.1

− 1.560574

0.000284

Down

TC03001056.hg.1

− 1.589272

0.000287

Down

TC09001898.hg.1

− 1.413369

0.000289

Down

TC02000955.hg.1

− 1.593632

0.000292

Down

TC02001432.hg.1

− 1.603841

0.000294

Down

TC03000195.hg.1

− 1.56613

0.000297

Down

TC01002877.hg.1

1.393011

3.00E−04

Up

TC02001366.hg.1

− 1.50307

0.000302

Down

TC06001365.hg.1

− 1.798942

0.000305

Down

TC21000483.hg.1

− 1.526505

0.000307

Down

TC11002486.hg.1

− 1.571098

0.00031

Down

TC10002723.hg.1

− 1.737066

0.000313

Down

TC09002408.hg.1

2.424384

0.000315

Up

TC02002994.hg.1

− 1.689071

0.000318

Down

TC01000642.hg.1

− 1.53535

0.00032

Down

TC14000620.hg.1

− 1.463791

0.000323

Down

TC07003059.hg.1

1.529988

0.000326

Up

TC21000650.hg.1

− 1.430525

0.000328

Down

TC11001010.hg.1

− 1.579571

0.000331

Down

TC05000526.hg.1

− 1.395094

0.000333

Down

TC09001461.hg.1

− 1.680036

0.000336

Down

TC09002258.hg.1

1.60311

0.000339

Up

TC07001656.hg.1

− 1.511784

0.000341

Down

TC10000439.hg.1

− 1.472641

0.000344

Down

TC05002279.hg.1

− 1.557636

0.000346

Down

TC14000775.hg.1

1.356138

0.000349

Up

TC14002059.hg.1

1.523057

0.000352

Up

TC15001184.hg.1

− 1.391194

0.000357

Down

TC11003147.hg.1

− 1.401112

0.000359

Down

TC07002742.hg.1

− 1.399246

0.000362

Down

TC08001864.hg.1

2.950612

0.000365

Up

TC09001602.hg.1

− 1.880185

0.000367

Down

TC05002800.hg.1

− 1.563391

0.00037

Down

TC11002476.hg.1

− 1.690386

0.000372

Down

TC07002321.hg.1

1.27127

0.000375

Up

TC01002633.hg.1

− 1.686971

0.000378

Down

TC05002022.hg.1

1.497479

0.00038

Up

TC17000728.hg.1

− 1.965686

0.000383

Down

TC10002300.hg.1

1.994904

0.000385

Up

TC01002746.hg.1

− 1.430809

0.000388

Down

TC05000708.hg.1

− 1.617304

0.000391

Down

TC17000491.hg.1

− 1.515315

0.000396

Down

TC09001534.hg.1

− 1.459227

0.000398

Down

TC12003194.hg.1

− 1.49803

0.000401

Down

TC12002688.hg.1

− 1.685657

0.000403

Down

TC04000508.hg.1

− 1.50861

0.000406

Down

TC01002620.hg.1

− 1.500063

0.000409

Down

TC21000887.hg.1

1.383973

0.000414

Up

TC18000603.hg.1

2.095404

0.000416

Up

TC02002711.hg.1

− 1.374202

0.000419

Down

TC01004110.hg.1

1.321687

0.000422

Up

TC06000824.hg.1

− 1.53592

0.000427

Down

TC01004763.hg.1

1.590669

0.000429

Up

TC12000558.hg.1

− 1.427752

0.000432

Down

TC20001202.hg.1

1.308112

0.000435

Up

TC07001267.hg.1

− 1.48023

0.000437

Down

TC06004031.hg.1

− 1.480003

0.00044

Down

TC22001053.hg.1

− 1.545286

0.000442

Down

TC0X001158.hg.1

− 1.890718

0.000445

Down

TC16002013.hg.1

− 1.631206

0.000448

Down

TC04002642.hg.1

− 1.43066

0.000453

Down

TC21000042.hg.1

2.453488

0.000455

Up

TC20001679.hg.1

1.762017

0.000458

Up

TC14001143.hg.1

− 1.26258

0.000461

Down

TC11002810.hg.1

1.384015

0.000463

Up

TC11001848.hg.1

1.462057

0.000466

Up

TC12003094.hg.1

− 1.4237

0.000468

Down

TC11002492.hg.1

− 1.316801

0.000471

Down

TC04000429.hg.1

1.289905

0.000474

Up

TC01005268.hg.1

2.055799

0.000476

Up

TC01000487.hg.1

1.354288

0.000479

Up

TC02001429.hg.1

− 1.455529

0.000487

Down

TC19001967.hg.1

1.548221

0.000489

Up

TC12000813.hg.1

− 1.316062

0.000492

Down

TC22001417.hg.1

− 1.597844

0.000494

Down

TC08000652.hg.1

− 1.574349

0.000497

Down

TC18000408.hg.1

1.572603

0.000499

Up

TC11003186.hg.1

1.33033

0.000502

Up

TC01004251.hg.1

1.32401

0.000505

Up

TC08002253.hg.1

− 2.279339

0.000507

Down

TC01002594.hg.1

− 1.779567

0.00051

Down

TC03003057.hg.1

1.407168

0.000512

Up

TC0X002258.hg.1

− 1.448026

0.000515

Down

TC14001731.hg.1

1.360459

0.000518

Up

TC11000031.hg.1

− 1.412204

0.00052

Down

TC08001833.hg.1

1.37955

0.000525

Up

TC03001342.hg.1

− 1.290438

0.000528

Down

TC17002307.hg.1

1.569429

0.000531

Up

TC04002813.hg.1

1.2442

0.000533

Up

TC05000688.hg.1

− 1.475197

0.000536

Down

TC05002034.hg.1

− 1.389715

0.000538

Down

TC12000088.hg.1

1.466129

0.000544

Up

TC05001142.hg.1

− 1.347908

0.000546

Down

TC06002303.hg.1

− 1.437374

0.000562

Down

TC09000586.hg.1

− 1.463022

0.000564

Down

TC15001796.hg.1

− 1.33117

0.000567

Down

TC17001193.hg.1

− 1.355381

0.00057

Down

TC06002340.hg.1

− 1.4849

0.000575

Down

TC05003112.hg.1

1.638048

0.000577

Up

TC06000705.hg.1

− 1.607894

0.000583

Down

TC12000238.hg.1

− 1.335439

0.000585

Down

TC01000565.hg.1

− 1.337671

0.000588

Down

TC02000092.hg.1

− 1.330873

0.00059

Down

TC0X002282.hg.1

− 1.325366

0.000593

Down

TC09000383.hg.1

− 1.274316

0.000598

Down

TC11003210.hg.1

1.231344

0.000601

Up

TC15001604.hg.1

− 1.487855

0.000603

Down

TC10002919.hg.1

− 1.480823

0.000606

Down

TC21000511.hg.1

1.377046

0.000611

Up

TC02003970.hg.1

− 1.387345

0.000616

Down

TC07002506.hg.1

− 1.369026

0.000619

Down

TC01003622.hg.1

1.356757

0.000621

Up

TC12001052.hg.1

− 1.676926

0.000624

Down

TC13000706.hg.1

− 1.254769

0.000627

Down

TC01004698.hg.1

1.469743

0.000632

Up

TC07001706.hg.1

− 1.439366

0.000636

Down

TC07001709.hg.1

− 1.439366

0.000636

Down

TC05001595.hg.1

− 1.447738

0.00064

Down

TC02001302.hg.1

− 1.576693

0.000642

Down

TC05001591.hg.1

− 1.203418

0.000645

Down

TC08002317.hg.1

− 1.330718

0.000647

Down

TC09000516.hg.1

− 1.664198

0.00065

Down

TC12002858.hg.1

1.350881

0.000655

Up

TC01005360.hg.1

1.271483

0.000658

Up

TC19001567.hg.1

1.505097

0.00066

Up

TC07000690.hg.1

− 1.411787

0.000663

Down

TC03001571.hg.1

− 1.477672

0.000666

Down

TC06002795.hg.1

1.436937

0.000668

Up

TC06003874.hg.1

− 1.29272

0.000671

Down

TC03002116.hg.1

− 1.412674

0.000673

Down

TC05000127.hg.1

1.513078

0.000676

Up

TC17002638.hg.1

1.348987

0.000679

Up

TC20000751.hg.1

− 1.402838

0.000681

Down

TC08002421.hg.1

− 1.74914

0.000684

Down

TC01005354.hg.1

1.229747

0.000686

Up

TC12003088.hg.1

− 1.281487

0.000689

Down

TC08001583.hg.1

− 1.537328

0.000691

Down

TC05000998.hg.1

− 1.483305

0.000694

Down

TC04001473.hg.1

− 1.432026

0.000697

Down

TC04002443.hg.1

− 1.487139

0.000702

Down

TC02000005.hg.1

− 1.472423

0.000704

Down

TC0X001624.hg.1

− 1.596058

0.000707

Down

TC04000461.hg.1

1.412843

0.00071

Up

TC08000450.hg.1

− 1.615791

0.000712

Down

TC18000833.hg.1

1.283471

0.000715

Up

TC01003671.hg.1

− 1.422938

0.00072

Down

TC01001291.hg.1

1.409687

0.000723

Up

TC10001432.hg.1

− 1.432311

0.000725

Down

TC17001310.hg.1

− 1.283493

0.000728

Down

TC08002093.hg.1

− 1.29301

0.00073

Down

TC20001234.hg.1

1.431939

0.000733

Up

TC11000270.hg.1

1.380022

0.000736

Up

TC06002451.hg.1

− 1.361116

0.000738

Down

TC02003138.hg.1

1.349475

0.000741

Up

TC05000183.hg.1

− 1.48138

0.000746

Down

TC01003990.hg.1

− 1.390426

0.000749

Down

TC02001762.hg.1

− 1.302759

0.000756

Down

TC0X001430.hg.1

− 1.470658

0.000762

Down

TC05001244.hg.1

1.28468

0.000764

Up

TC16001854.hg.1

− 1.274852

0.000767

Down

TC19000179.hg.1

− 1.220968

0.000769

Down

TC01005416.hg.1

1.308645

0.000772

Up

TC21000041.hg.1

1.720569

0.000777

Up

TC06002615.hg.1

1.698567

0.000782

Up

TC0X001210.hg.1

− 1.72284

0.000787

Down

TC08000385.hg.1

− 1.30756

0.00079

Down

TC01001501.hg.1

− 1.261062

0.000793

Down

TC11000882.hg.1

1.360165

0.000795

Up

TC17002123.hg.1

1.252373

0.000798

Up

TC10001266.hg.1

− 1.270974

8.00E−04

Down

TC04000223.hg.1

− 1.399388

0.000803

Down

TC02004784.hg.1

− 1.270101

0.000806

Down

TC03003257.hg.1

− 1.473539

0.000811

Down

TC11002784.hg.1

1.544173

0.000816

Up

TC17000637.hg.1

1.549618

0.000821

Up

TC21000447.hg.1

− 1.357028

0.000824

Down

TC16001066.hg.1

− 1.250451

0.000826

Down

TC10001922.hg.1

1.308392

0.000834

Up

TC11002991.hg.1

− 1.203628

0.000839

Down

TC03003014.hg.1

− 1.272182

0.000845

Down

TC05001291.hg.1

− 1.22311

0.000847

Down

TC11002432.hg.1

− 1.294734

0.00085

Down

TC07000282.hg.1

− 1.386049

0.000852

Down

TC0X001907.hg.1

1.514463

0.000855

Up

TC12000589.hg.1

− 1.437338

0.000858

Down

TC01001111.hg.1

1.562931

0.00086

Up

TC08000734.hg.1

− 1.2404

0.000863

Down

TC0X000649.hg.1

− 1.204547

0.000865

Down

TC12000005.hg.1

− 1.230721

0.000868

Down

TC06003061.hg.1

1.681888

0.000871

Up

TC11000655.hg.1

− 1.343701

0.000873

Down

TC09000963.hg.1

− 1.43499

0.000881

Down

TC15002417.hg.1

− 1.286319

0.000883

Down

TC07003181.hg.1

− 1.334931

0.000886

Down

TC10001115.hg.1

1.283726

0.000889

Up

TC12000578.hg.1

1.240881

0.000891

Up

TC01005437.hg.1

1.248673

0.000894

Up

TC17002178.hg.1

− 1.402437

0.000896

Down

TC14001936.hg.1

1.238815

0.000899

Up

TC14000725.hg.1

− 1.30455

0.000904

Down

TC13000186.hg.1

− 1.264527

0.000907

Down

TC05002042.hg.1

− 1.348682

0.000909

Down

TC12001770.hg.1

1.739266

0.000917

Up

TC17001656.hg.1

− 1.467195

0.000922

Down

TC01005905.hg.1

− 1.214045

0.000925

Down

TC0Y000302.hg.1

− 1.280838

0.000931

Down

TC0Y000304.hg.1

− 1.280838

0.000931

Down

TC02004706.hg.1

1.367562

0.000935

Up

TC06003540.hg.1

1.286007

0.000938

Up

TC12001099.hg.1

− 1.215286

0.000941

Down

TC10000843.hg.1

1.313133

0.000943

Up

TC03001294.hg.1

1.437371

0.000946

Up

TC15000406.hg.1

− 1.277322

0.000948

Down

TC05002576.hg.1

− 1.39417

0.000951

Down

TC14000991.hg.1

1.299653

0.000954

Up

TC02003574.hg.1

− 1.248912

0.000956

Down

TC15002494.hg.1

− 1.335358

0.000959

Down

TC10001764.hg.1

− 1.280423

0.000961

Down

TC02001836.hg.1

− 1.445879

0.000964

Down

TC06000102.hg.1

− 1.497939

0.000969

Down

TC03001531.hg.1

1.252613

0.000972

Up

TC08001082.hg.1

− 1.277646

0.000977

Down

TC03000629.hg.1

− 1.58654

0.00098

Down

TC04000854.hg.1

− 1.369976

0.000982

Down

TC0X000283.hg.1

− 1.606025

0.000987

Down

TC02003376.hg.1

1.288982

0.00099

Up

TC16001973.hg.1

1.416974

0.000995

Up

TC09001936.hg.1

− 1.55743

0.000998

Down

TC14002181.hg.1

− 1.292272

0.001

Down

TC19002169.hg.1

1.292553

0.001003

Up

TC22001135.hg.1

− 1.237744

0.001008

Down

TC14001911.hg.1

1.226465

0.001013

Up

TC04001384.hg.1

1.326226

0.001016

Up

TC09002810.hg.1

− 1.253762

0.001018

Down

TC01006061.hg.1

1.239967

0.001024

Up

TC09002176.hg.1

− 1.252655

0.001026

Down

TC0X001762.hg.1

− 1.338176

0.001029

Down

TC07000339.hg.1

− 1.441623

0.001034

Down

TC18000715.hg.1

− 1.339535

0.001039

Down

TC20001391.hg.1

1.279887

0.001042

Up

TC04001218.hg.1

1.463061

0.001044

Up

TC01005893.hg.1

− 1.235444

0.001047

Down

TC03001845.hg.1

1.468478

0.001052

Up

TC01006068.hg.1

− 1.684105

0.001055

Down

TC20000564.hg.1

− 1.33301

0.001057

Down

TC20000106.hg.1

1.445871

0.00106

Up

TC04000543.hg.1

1.606432

0.001063

Up

TC12000805.hg.1

− 1.359918

0.001065

Down

TC04001743.hg.1

1.217508

0.001068

Up

TC09000060.hg.1

− 1.302308

0.00107

Down

TC03001672.hg.1

− 1.340418

0.001073

Down

TC08002335.hg.1

− 1.675618

0.001076

Down

TC09001709.hg.1

− 1.550874

0.001078

Down

TC21000663.hg.1

1.304123

0.001081

Up

TC08002008.hg.1

1.368127

0.001083

Up

TC20000053.hg.1

− 1.230537

0.001088

Down

TC01003510.hg.1

− 1.353839

0.001091

Down

TC11002378.hg.1

1.452002

0.001094

Up

TC03001943.hg.1

− 1.331955

0.001099

Down

TC05002812.hg.1

− 1.25135

0.001101

Down

TC03001366.hg.1

− 1.383993

0.001104

Down

TC01002044.hg.1

1.389355

0.001107

Up

TC03002276.hg.1

− 1.385647

0.001109

Down

TC12000315.hg.1

− 1.378694

0.001112

Down

TC02000413.hg.1

− 1.31176

0.001114

Down

TC08002504.hg.1

− 1.386422

0.001117

Down

TC01001142.hg.1

1.505991

0.001127

Up

TC07001801.hg.1

1.753925

0.00113

Up

TC05002870.hg.1

1.302868

0.001133

Up

TC02002904.hg.1

− 1.387138

0.001135

Down

TC11001108.hg.1

1.530186

0.00114

Up

TC13001025.hg.1

1.287199

0.001146

Up

TC09001939.hg.1

− 1.354181

0.001148

Down

TC19000963.hg.1

1.281426

0.001156

Up

TC14000314.hg.1

1.326006

0.001159

Up

TC06002689.hg.1

1.339061

0.001161

Up

TC11000768.hg.1

− 1.28868

0.001164

Down

TC12000107.hg.1

1.674608

0.001166

Up

TC07002087.hg.1

− 1.291715

0.001172

Down

TC02003914.hg.1

− 1.506351

0.001174

Down

TC11002142.hg.1

− 1.78159

0.001177

Down

TC01002397.hg.1

− 1.278246

0.001179

Down

TC19000409.hg.1

− 1.323654

0.001182

Down

TC02001844.hg.1

1.297798

0.001187

Up

TC07001099.hg.1

− 1.298125

0.00119

Down

TC01004750.hg.1

− 1.393313

0.001192

Down

TC05001001.hg.1

− 1.289514

0.001195

Down

TC14001735.hg.1

1.217484

0.0012

Up

TC02004275.hg.1

− 1.283611

0.001203

Down

TC08001850.hg.1

1.293788

0.001205

Up

TC09000043.hg.1

1.326023

0.001208

Up

TC02000138.hg.1

1.378171

0.00121

Up

TC0X002006.hg.1

− 1.254125

0.001213

Down

TC05001174.hg.1

1.248122

0.001216

Up

TC18000381.hg.1

− 1.439065

0.001218

Down

TC0X002099.hg.1

1.697539

0.001221

Up

TC15001301.hg.1

1.38106

0.001223

Up

TC01000109.hg.1

1.392654

0.001231

Up

TC0X001298.hg.1

1.461986

0.001234

Up

TC0X001901.hg.1

− 1.233679

0.001239

Down

TC04002100.hg.1

− 1.359631

0.001244

Down

TC20000460.hg.1

− 1.318744

0.001247

Down

TC0X000064.hg.1

1.391058

0.001252

Up

TC0X001094.hg.1

− 1.429617

0.001257

Down

TC11002051.hg.1

− 1.484736

0.00126

Down

TC12001929.hg.1

− 1.342651

0.001265

Down

TC11003367.hg.1

1.656682

0.001268

Up

TC02003380.hg.1

1.301934

0.001275

Up

TC21000762.hg.1

1.361985

0.001278

Up

TC0M000023.hg.1

1.382876

0.00128

Up

TC02004390.hg.1

1.446827

0.001283

Up

TC10002633.hg.1

− 1.301706

0.001288

Down

TC01006076.hg.1

− 1.245012

0.001291

Down

TC12002203.hg.1

1.526303

0.001296

Up

TC11002740.hg.1

− 1.283389

0.001299

Down

TC04002160.hg.1

− 1.262713

0.001301

Down

TC17002633.hg.1

1.378591

0.001304

Up

TC12001768.hg.1

− 1.398601

0.001306

Down

TC04002095.hg.1

1.241208

0.001312

Up

TC05001178.hg.1

1.339261

0.001317

Up

TC04001688.hg.1

1.362728

0.001319

Up

TC10002901.hg.1

− 1.278397

0.001322

Down

TC15001808.hg.1

1.434852

0.00133

Up

TC04000710.hg.1

1.355916

0.001332

Up

TC10002092.hg.1

1.281193

0.001335

Up

TC09002305.hg.1

1.26724

0.001343

Up

TC12000651.hg.1

− 1.351627

0.001345

Down

TC10001511.hg.1

− 1.316949

0.001356

Down

TC01000472.hg.1

− 1.298179

0.001358

Down

TC11003246.hg.1

1.335547

0.001366

Up

TC11000161.hg.1

− 1.27089

0.001374

Down

TC12000359.hg.1

1.237241

0.001379

Up

TC12001702.hg.1

− 1.275897

0.001382

Down

TC08001540.hg.1

− 1.346581

0.001384

Down

TC08001886.hg.1

1.259731

0.001387

Up

TC13000269.hg.1

− 1.424301

0.001389

Down

TC01005067.hg.1

1.487055

0.001392

Up

TC01003976.hg.1

1.273839

0.001395

Up

TC10000265.hg.1

1.547355

0.001402

Up

TC04001202.hg.1

− 1.265554

0.001405

Down

TC02001892.hg.1

− 1.479308

0.00141

Down

TC0X001653.hg.1

− 1.20304

0.001413

Down

TC17001939.hg.1

− 1.305775

0.001415

Down

TC14001708.hg.1

1.42332

0.001423

Up

TC20001199.hg.1

− 1.794386

0.001426

Down

TC06004094.hg.1

− 1.213016

0.001434

Down

TC11003053.hg.1

1.483375

0.001436

Up

TC01001470.hg.1

− 1.244999

0.001439

Down

TC04001675.hg.1

1.367312

0.001441

Up

TC05001384.hg.1

− 1.20032

0.001444

Down

TC22000509.hg.1

1.20276

0.001449

Up

TC10000687.hg.1

1.301899

0.001454

Up

TC11000849.hg.1

1.465989

0.001457

Up

TC15002506.hg.1

1.432903

0.00146

Up

TC14001281.hg.1

− 1.515784

0.001462

Down

TC05002143.hg.1

− 1.507259

0.001465

Down

TC07001428.hg.1

− 1.281883

0.001467

Down

TC07002487.hg.1

− 1.220035

0.001472

Down

TC13000434.hg.1

− 1.269599

0.001475

Down

TC17000700.hg.1

1.521397

0.001478

Up

TC06000356.hg.1

1.234269

0.00148

Up

TC07000879.hg.1

1.442272

0.001483

Up

TC16000168.hg.1

− 1.307892

0.001485

Down

TC07002026.hg.1

− 1.230563

0.001491

Down

TC15002522.hg.1

− 1.247948

0.001493

Down

TC03002349.hg.1

1.308143

0.001496

Up

TC04001294.hg.1

− 1.255584

0.001498

Down

TC01005264.hg.1

− 1.438176

0.001501

Down

TC05002959.hg.1

− 1.301601

0.001504

Down

TC08001642.hg.1

1.379421

0.001506

Up

TC12001758.hg.1

− 1.281904

0.001509

Down

TC11002955.hg.1

1.23146

0.001514

Up

TC01006001.hg.1

− 1.231238

0.001519

Down

TC11001275.hg.1

− 1.326731

0.001522

Down

TC09000835.hg.1

− 1.232379

0.001524

Down

TC10001178.hg.1

1.259514

0.001527

Up

TC01004281.hg.1

− 1.281757

0.00153

Down

TC12002368.hg.1

− 1.214252

0.001532

Down

TC03002510.hg.1

− 1.22681

0.001537

Down

TC18000199.hg.1

1.359443

0.00154

Up

TC03000889.hg.1

− 1.378763

0.001548

Down

TC16001163.hg.1

1.522691

0.001553

Up

TC16000573.hg.1

− 1.384428

0.001561

Down

TC22001327.hg.1

− 1.261884

0.001563

Down

TC19000423.hg.1

− 1.349595

0.001566

Down

TC19000016.hg.1

− 1.203688

0.001569

Down

TC12000395.hg.1

1.483422

0.001571

Up

TC07002238.hg.1

1.258405

0.001574

Up

TC0X000584.hg.1

1.568076

0.001576

Up

TC15002609.hg.1

1.230717

0.001584

Up

TC05002180.hg.1

− 1.289242

0.001587

Down

TC12001542.hg.1

1.248048

0.001594

Up

TC09002127.hg.1

− 1.251934

0.001597

Down

TC01005541.hg.1

1.349643

0.0016

Up

TC13000759.hg.1

1.325838

0.001602

Up

TC03002654.hg.1

1.573194

0.001605

Up

TC04000264.hg.1

− 1.242144

0.001607

Down

TC10001183.hg.1

1.254169

0.00161

Up

TC02001767.hg.1

1.501282

0.001613

Up

TC16001787.hg.1

− 1.23458

0.001615

Down

TC16001996.hg.1

− 1.413337

0.00162

Down

TC16001381.hg.1

− 1.250738

0.001626

Down

TC20001170.hg.1

− 1.215293

0.001628

Down

TC0X001367.hg.1

1.327188

0.001631

Up

TC05002924.hg.1

− 1.38887

0.001639

Down

TC01005172.hg.1

− 1.413469

0.001646

Down

TC06000650.hg.1

− 1.207228

0.001649

Down

TC02004514.hg.1

− 1.251876

0.001652

Down

TC14000850.hg.1

− 1.358753

0.001654

Down

TC04001198.hg.1

1.27254

0.001657

Up

TC0X000282.hg.1

− 1.384996

0.001659

Down

TC08000176.hg.1

− 1.262382

0.001662

Down

TC19002431.hg.1

− 1.271144

0.001667

Down

TC07000154.hg.1

1.214019

0.001672

Up

TC15001223.hg.1

1.41761

0.001677

Up

TC15000346.hg.1

1.607314

0.001685

Up

TC02003220.hg.1

− 1.220085

0.001693

Down

TC02001567.hg.1

− 1.514096

0.001696

Down

TC07003062.hg.1

1.473937

0.001701

Up

TC16001481.hg.1

− 1.256589

0.001703

Down

TC11002658.hg.1

− 1.243073

0.001706

Down

TC20000800.hg.1

− 1.22335

0.001714

Down

TC01004190.hg.1

− 1.280267

0.001719

Down

TC10000755.hg.1

− 1.500832

0.001727

Down

TC07002475.hg.1

1.335462

0.001748

Up

TC09000471.hg.1

− 1.258358

0.001758

Down

TC0X001618.hg.1

− 1.273233

0.001761

Down

TC01003152.hg.1

1.441204

0.001768

Up

TC20000841.hg.1

− 1.313791

0.001771

Down

TC05002975.hg.1

− 1.309682

0.001779

Down

TC08001847.hg.1

1.406037

0.001784

Up

TC02003913.hg.1

− 1.372422

0.001786

Down

TC10002891.hg.1

− 1.201915

0.001792

Down

TC19001852.hg.1

1.491505

0.001794

Up

TC03002962.hg.1

− 1.248919

0.001805

Down

TC01005988.hg.1

− 1.415789

0.001812

Down

TC01006043.hg.1

− 1.359798

0.001818

Down

TC14000381.hg.1

1.281079

0.00182

Up

TC12000580.hg.1

1.735542

0.001825

Up

TC01002098.hg.1

− 1.253355

0.001831

Down

TC02001032.hg.1

− 1.303562

0.001833

Down

TC04001271.hg.1

1.318074

0.001836

Up

TC11000769.hg.1

− 1.271684

0.001838

Down

TC03001559.hg.1

1.416685

0.001844

Up

TC09001810.hg.1

− 1.270957

0.001846

Down

TC08001514.hg.1

− 1.204519

0.001851

Down

TC14001530.hg.1

− 1.323404

0.001854

Down

TC02003388.hg.1

− 1.23358

0.001864

Down

TC0X000822.hg.1

− 1.718844

0.001867

Down

TC17002619.hg.1

− 1.211196

0.001877

Down

TC07000080.hg.1

− 1.269449

0.00188

Down

TC09002217.hg.1

− 1.319933

0.001882

Down

TC01003082.hg.1

1.682659

0.001894

Up

TC01003146.hg.1

1.682659

0.001894

Up

TC07001692.hg.1

1.305275

0.001901

Up

TC04001091.hg.1

− 1.284332

0.001903

Down

TC15001480.hg.1

− 1.38294

0.001911

Down

TC06002096.hg.1

− 1.296343

0.001914

Down

TC20001131.hg.1

1.239192

0.001916

Up

TC10001843.hg.1

− 1.279966

0.001919

Down

TC06002013.hg.1

1.468244

0.001924

Up

TC04001248.hg.1

1.498609

0.001927

Up

TC11002681.hg.1

1.284111

0.001929

Up

TC07003058.hg.1

− 1.28452

0.00194

Down

TC19002000.hg.1

− 1.245035

0.001942

Down

TC22000340.hg.1

1.589672

0.001945

Up

TC01002805.hg.1

1.202882

0.00195

Up

TC04000366.hg.1

1.409609

0.001953

Up

TC09000159.hg.1

− 1.312322

0.001958

Down

TC10001198.hg.1

− 1.357252

0.00196

Down

TC06000940.hg.1

1.265177

0.001963

Up

TC17001752.hg.1

1.334898

0.001965

Up

TC22001201.hg.1

− 2.439349

0.001973

Down

TC05003153.hg.1

− 1.240737

0.001976

Down

TC17002053.hg.1

− 1.244021

0.001978

Down

TC01003999.hg.1

− 1.700442

0.001986

Down

TC04002855.hg.1

− 1.268654

0.001989

Down

TC14000667.hg.1

1.399213

0.001991

Up

TC04001141.hg.1

− 1.525018

0.001994

Down

TC01005544.hg.1

1.237713

0.002002

Up

TC0X001406.hg.1

1.230021

0.002007

Up

TC05001662.hg.1

1.440258

0.00201

Up

TC11000282.hg.1

− 1.356168

0.002015

Down

TC21000954.hg.1

− 1.296443

0.002017

Down

TC08001129.hg.1

− 1.472614

0.002023

Down

TC06004012.hg.1

− 1.212754

0.002028

Down

TC17002825.hg.1

1.349775

0.00203

Up

TC06004016.hg.1

− 1.239402

0.002038

Down

TC10002884.hg.1

1.431763

0.002043

Up

TC05003136.hg.1

1.353844

0.002049

Up

TC12001421.hg.1

1.333251

0.002056

Up

TC15001280.hg.1

1.343707

0.00206

Up

TC15001283.hg.1

1.343707

0.00206

Up

TC14000739.hg.1

1.38166

0.002103

Up

TC10002474.hg.1

1.331327

0.002111

Up

TC14000601.hg.1

− 1.288544

0.002113

Down

TC11002989.hg.1

− 1.321635

0.002116

Down

TC0X001753.hg.1

− 1.205232

0.002119

Down

TC17000925.hg.1

1.272254

0.002121

Up

TC17000253.hg.1

1.345784

0.002124

Up

TC21000698.hg.1

− 1.374031

0.002137

Down

TC02001905.hg.1

1.328816

0.002147

Up

TC06002227.hg.1

− 1.498561

0.00215

Down

TC07000555.hg.1

− 1.337119

0.002152

Down

TC09002594.hg.1

1.339428

0.002155

Up

TC12001568.hg.1

1.341653

0.002157

Up

TC05001229.hg.1

1.360326

0.002165

Up

TC04001597.hg.1

− 1.331486

0.00217

Down

TC07002682.hg.1

− 1.221462

0.002173

Down

TC08001671.hg.1

1.488276

0.002176

Up

TC12002539.hg.1

− 1.275317

0.002178

Down

TC09002851.hg.1

− 1.333711

0.002181

Down

TC01000483.hg.1

1.552037

0.002186

Up

TC06003970.hg.1

− 1.368856

0.002189

Down

TC15002586.hg.1

− 1.340035

0.002191

Down

TC12002612.hg.1

− 1.256137

0.002196

Down

TC09001443.hg.1

− 1.207418

0.002212

Down

TC03001682.hg.1

1.260171

0.002215

Up

TC17000782.hg.1

− 1.204102

0.002217

Down

TC15000597.hg.1

1.213718

0.00222

Up

TC06003660.hg.1

− 1.237973

0.002222

Down

TC17002039.hg.1

1.340985

0.002225

Up

TC03002816.hg.1

− 1.247147

0.002228

Down

TC09000100.hg.1

− 1.377179

0.00223

Down

TC12002319.hg.1

− 1.211631

0.002235

Down

TC02002799.hg.1

− 1.264613

0.002241

Down

TC07000677.hg.1

− 1.215502

0.002246

Down

TC07000516.hg.1

1.289644

0.002248

Up

TC0X000501.hg.1

− 1.324115

0.002254

Down

TC16001448.hg.1

1.236904

0.002259

Up

TC07002912.hg.1

− 1.326523

0.002266

Down

TC10001062.hg.1

1.412222

0.002269

Up

TC10000761.hg.1

1.583303

0.002272

Up

TC05000214.hg.1

− 1.353026

0.002274

Down

TC09002468.hg.1

1.209262

0.002282

Up

TC12001658.hg.1

1.437781

0.002285

Up

TC03001924.hg.1

1.271901

0.00229

Up

TC03003246.hg.1

1.207269

0.002295

Up

TC14001678.hg.1

1.530119

0.0023

Up

TC03002629.hg.1

− 1.225872

0.002313

Down

TC20001519.hg.1

− 1.220912

0.002321

Down

TC01006051.hg.1

− 1.336503

0.002324

Down

TC06002665.hg.1

1.461845

0.002331

Up

TC02001522.hg.1

− 1.248588

0.002334

Down

TC12002293.hg.1

− 1.209515

0.002342

Down

TC21000628.hg.1

− 1.231307

0.002344

Down

TC12001919.hg.1

− 1.351643

0.002347

Down

TC02001799.hg.1

− 2.445831

0.00235

Down

TC17000742.hg.1

− 1.320632

0.002357

Down

TC04002002.hg.1

− 1.303665

0.00236

Down

TC0X001976.hg.1

1.267861

0.00237

Up

TC11002465.hg.1

− 1.277875

0.002383

Down

TC09001504.hg.1

− 1.312141

0.002388

Down

TC05000162.hg.1

1.294054

0.002391

Up

TC06003710.hg.1

− 1.344179

0.002399

Down

TC15002646.hg.1

1.2472

0.002401

Up

TC03002025.hg.1

− 1.217553

0.002417

Down

TC08000782.hg.1

1.360634

0.002422

Up

TC12001854.hg.1

− 1.235064

0.002427

Down

TC15000426.hg.1

− 1.229315

0.002435

Down

TC15002177.hg.1

1.279118

0.00244

Up

TC22001207.hg.1

− 1.203482

0.002451

Down

TC03002554.hg.1

− 1.220846

0.002458

Down

TC11000720.hg.1

1.488337

0.002461

Up

TC12003053.hg.1

1.261293

0.002471

Up

TC01003159.hg.1

1.455932

0.002479

Up

TC03000673.hg.1

− 1.307368

0.002484

Down

TC12001455.hg.1

− 1.316009

0.002487

Down

TC05000503.hg.1

− 1.223516

0.002497

Down

TC01002453.hg.1

1.461387

0.002508

Up

TC09002781.hg.1

1.429014

0.002518

Up

TC02000495.hg.1

1.291697

0.002529

Up

TC20001320.hg.1

1.297954

0.002531

Up

TC01004677.hg.1

− 1.285666

0.002534

Down

TC03000004.hg.1

− 1.234276

0.002539

Down

TC07000031.hg.1

1.223867

0.002557

Up

TC18000275.hg.1

− 1.277381

0.00256

Down

TC01003175.hg.1

1.43838

0.002565

Up

TC18000216.hg.1

− 1.286168

0.002567

Down

TC01006192.hg.1

1.268851

0.002573

Up

TC08000259.hg.1

− 1.344703

0.002583

Down

TC04001562.hg.1

1.450228

0.002593

Up

TC03003056.hg.1

1.215057

0.002601

Up

TC12001883.hg.1

1.569242

0.002609

Up

TC01003899.hg.1

− 1.28947

0.002617

Down

TC0Y000064.hg.1

1.200448

0.002628

Up

TC0Y000173.hg.1

1.200448

0.002628

Up

TC09000674.hg.1

− 1.2102

0.002635

Down

TC04000005.hg.1

− 1.295829

0.002638

Down

TC17002085.hg.1

− 1.281199

0.00264

Down

TC01001139.hg.1

1.508166

0.00265

Up

TC20001755.hg.1

1.352651

0.002656

Up

TC02002970.hg.1

− 1.429192

0.002658

Down

TC07002772.hg.1

1.373647

0.002661

Up

TC11001556.hg.1

− 1.206529

0.002666

Down

TC04002294.hg.1

− 1.401452

0.002671

Down

TC01005305.hg.1

1.356928

0.002676

Up

TC15001904.hg.1

− 1.272703

0.002682

Down

TC20000317.hg.1

1.430596

0.002687

Up

TC08000740.hg.1

1.402556

0.002692

Up

TC09001635.hg.1

− 1.276086

0.0027

Down

TC13001064.hg.1

− 1.26174

0.002702

Down

TC02003591.hg.1

1.299115

0.00271

Up

TC07002773.hg.1

1.331845

0.002721

Up

TC05002891.hg.1

− 1.259569

0.002726

Down

TC09002429.hg.1

− 1.205487

0.002728

Down

TC06001125.hg.1

− 1.232463

0.002734

Down

TC03002933.hg.1

− 1.211047

0.002744

Down

TC09002223.hg.1

− 1.202365

0.002746

Down

TC01004768.hg.1

− 1.224528

0.002757

Down

TC08000722.hg.1

1.365601

0.002762

Up

TC03001348.hg.1

− 1.239947

0.002767

Down

TC09002651.hg.1

− 1.69314

0.002778

Down

TC07002574.hg.1

− 1.24146

0.002788

Down

TC08000076.hg.1

1.404643

0.002793

Up

TC05000182.hg.1

1.301406

0.002804

Up

TC0X000127.hg.1

− 1.20556

0.002809

Down

TC03000962.hg.1

− 1.382564

0.002819

Down

TC07000246.hg.1

− 1.267632

0.002827

Down

TC07000320.hg.1

1.341276

0.002835

Up

TC11002734.hg.1

1.297811

0.002843

Up

TC17001691.hg.1

− 1.271637

0.002848

Down

TC01001837.hg.1

1.550832

0.00285

Up

TC20000915.hg.1

− 1.232658

0.002863

Down

TC02003364.hg.1

− 1.266053

0.002871

Down

TC0X001104.hg.1

1.359394

0.002889

Up

TC01000711.hg.1

− 1.216828

0.002892

Down

TC17000989.hg.1

− 1.21244

0.002894

Down

TC02002022.hg.1

1.263206

0.002897

Up

TC07002067.hg.1

− 1.31306

0.0029

Down

TC07001289.hg.1

− 1.351691

0.002902

Down

TC01000295.hg.1

1.305782

0.002905

Up

TC06000662.hg.1

1.480994

0.002907

Up

TC19002432.hg.1

− 1.286462

0.00291

Down

TC14002087.hg.1

− 1.270823

0.002918

Down

TC05002826.hg.1

1.273654

0.00292

Up

TC04001876.hg.1

− 1.318727

0.002936

Down

TC07002081.hg.1

− 1.319864

0.002939

Down

TC20001277.hg.1

1.278604

0.002946

Up

TC05000501.hg.1

1.274401

0.002962

Up

TC10000590.hg.1

1.370535

0.002977

Up

TC15001485.hg.1

− 1.291058

0.002993

Down

TC15002487.hg.1

− 1.367271

0.003006

Down

TC21000774.hg.1

− 1.289989

0.003009

Down

TC02002679.hg.1

− 1.293013

0.003011

Down

TC07001604.hg.1

1.354263

0.003014

Up

TC12001252.hg.1

1.447457

0.003016

Up

TC13001458.hg.1

− 1.207147

0.003019

Down

TC09002644.hg.1

− 1.26481

0.003022

Down

TC0X001878.hg.1

− 1.209099

0.003024

Down

TC0X001302.hg.1

1.569258

0.003027

Up

TC18000294.hg.1

1.260461

0.003045

Up

TC08000507.hg.1

− 1.315641

0.003055

Down

TC08000970.hg.1

− 1.224392

0.003058

Down

TC05002688.hg.1

− 1.2392

0.00306

Down

TC11003229.hg.1

− 1.251246

0.003063

Down

TC09002325.hg.1

− 1.270503

0.003076

Down

TC10002238.hg.1

− 1.329862

0.003081

Down

TC06001064.hg.1

− 1.274065

0.003092

Down

TC02003391.hg.1

− 1.362446

0.003099

Down

TC10000133.hg.1

− 1.238252

0.003103

Down

TC10000136.hg.1

− 1.238252

0.003103

Down

TC03002201.hg.1

− 1.331047

0.003112

Down

TC07001869.hg.1

− 1.488884

0.003118

Down

TC15001493.hg.1

− 1.20754

0.003125

Down

TC15002311.hg.1

− 1.221615

0.003136

Down

TC07001788.hg.1

− 1.398937

0.003143

Down

TC06003354.hg.1

− 1.228478

0.003146

Down

TC07002240.hg.1

1.460799

0.003151

Up

TC01000348.hg.1

− 1.280176

0.003162

Down

TC05000429.hg.1

− 1.204846

0.003172

Down

TC10002375.hg.1

− 1.214255

0.003175

Down

TC11001740.hg.1

1.307581

0.003177

Up

TC11000061.hg.1

1.501956

0.00318

Up

TC16000236.hg.1

1.306824

0.003203

Up

TC07001599.hg.1

− 1.353408

0.003211

Down

TC08001580.hg.1

− 1.29275

0.003219

Down

TC20000677.hg.1

− 1.209774

0.003221

Down

TC0X001145.hg.1

1.32182

0.003227

Up

TC19000162.hg.1

− 1.296602

0.003232

Down

TC0X001119.hg.1

1.23651

0.003258

Up

TC16001238.hg.1

1.548063

0.00326

Up

TC04000904.hg.1

− 1.325403

0.003281

Down

TC01004933.hg.1

1.296042

0.003284

Up

TC03002799.hg.1

1.233829

0.003286

Up

TC17001438.hg.1

− 1.282082

0.003307

Down

TC12002384.hg.1

1.229617

0.003315

Up

TC06003692.hg.1

− 1.256837

0.003323

Down

TC06001254.hg.1

− 1.229231

0.003328

Down

TC21000398.hg.1

− 1.279981

0.003333

Down

TC06000858.hg.1

1.611132

0.003341

Up

TC15001164.hg.1

− 1.235207

0.003343

Down

TC01000551.hg.1

1.249583

0.003348

Up

TC12003054.hg.1

1.220865

0.003354

Up

TC18000207.hg.1

1.207556

0.003359

Up

TC16001555.hg.1

− 1.235816

0.003369

Down

TC07000470.hg.1

1.268777

0.003372

Up

TC06001808.hg.1

1.248183

0.003385

Up

TC01000364.hg.1

− 1.330246

0.003387

Down

TC12000919.hg.1

1.563172

0.00339

Up

TC05001064.hg.1

1.565417

0.003393

Up

TC17002281.hg.1

− 1.200596

0.003411

Down

TC10000082.hg.1

− 1.375037

0.00346

Down

TC02003240.hg.1

− 1.307516

0.003481

Down

TC04001241.hg.1

− 1.290744

0.003491

Down

TC02004324.hg.1

− 1.232763

0.003494

Down

TC10002413.hg.1

− 1.245515

0.003515

Down

TC16001946.hg.1

− 1.22412

0.003525

Down

TC02002923.hg.1

− 1.276668

0.003528

Down

TC09002766.hg.1

− 1.258491

0.003535

Down

TC09000642.hg.1

− 1.347036

0.003538

Down

TC02001155.hg.1

− 1.210161

0.003548

Down

TC17000690.hg.1

− 1.278329

0.003556

Down

TC22000690.hg.1

− 1.201581

0.003564

Down

TC03001758.hg.1

− 1.260934

0.003566

Down

TC10002858.hg.1

− 1.261472

0.0036

Down

TC01001573.hg.1

− 1.31615

0.003608

Down

TC12000943.hg.1

− 1.20209

0.003613

Down

TC07000478.hg.1

− 1.269749

0.003626

Down

TC22001006.hg.1

− 1.20719

0.003636

Down

TC21000941.hg.1

− 1.364074

0.003655

Down

TC07002774.hg.1

− 1.224753

0.00366

Down

TC06003965.hg.1

− 1.238846

0.003665

Down

TC0Y000049.hg.1

− 1.363073

0.003675

Down

TC04000236.hg.1

− 1.212799

0.003681

Down

TC0X001770.hg.1

− 1.33727

0.003691

Down

TC06003404.hg.1

− 1.327154

0.003694

Down

TC05001562.hg.1

− 1.380095

0.003699

Down

TC05001222.hg.1

− 1.267421

0.003725

Down

TC01005060.hg.1

− 1.314409

0.003727

Down

TC03000359.hg.1

− 1.202882

0.003751

Down

TC08001194.hg.1

− 1.424464

0.003753

Down

TC09001332.hg.1

− 1.371182

0.003782

Down

TC07001668.hg.1

− 1.221176

0.003816

Down

TC06000609.hg.1

− 1.2365

0.003834

Down

TC14002171.hg.1

− 1.305933

0.003839

Down

TC05003054.hg.1

− 1.216461

0.003841

Down

TC12000990.hg.1

− 1.45711

0.003854

Down

TC18000510.hg.1

− 1.260881

0.003862

Down

TC04000456.hg.1

− 1.263786

0.00388

Down

TC01000871.hg.1

− 1.21274

0.003896

Down

TC16000865.hg.1

− 1.285648

0.003899

Down

TC06002606.hg.1

− 1.49097

0.003927

Down

TC22000272.hg.1

− 1.554161

0.003932

Down

TC06002746.hg.1

− 1.202909

0.00394

Down

TC0Y000257.hg.1

− 1.281043

0.003945

Down

TC18000540.hg.1

− 1.251836

0.003948

Down

TC08002048.hg.1

− 1.207051

0.003966

Down

TC17002700.hg.1

− 1.235688

0.003974

Down

TC05001722.hg.1

− 1.273013

0.003982

Down

TC01005183.hg.1

− 1.227973

0.003987

Down

TC12002485.hg.1

− 1.260362

0.004

Down

TC10001548.hg.1

− 1.301554

0.004002

Down

TC13001206.hg.1

− 1.467406

0.004005

Down

TC11003065.hg.1

− 1.232606

0.004013

Down

TC10000091.hg.1

− 1.407866

0.004018

Down

TC06004002.hg.1

− 1.324321

0.00402

Down

TC02004420.hg.1

− 1.245413

0.004057

Down

TC02002409.hg.1

− 1.296558

0.004059

Down

TC05002084.hg.1

− 1.429991

0.004067

Down

TC03000687.hg.1

− 1.368897

0.004096

Down

TC05002736.hg.1

− 1.269686

0.004101

Down

TC11000172.hg.1

− 1.381513

0.004117

Down

TC04000860.hg.1

− 1.20631

0.004197

Down

TC13001692.hg.1

− 1.204469

0.004202

Down

TC03002000.hg.1

− 1.245183

0.00421

Down

TC0X000016.hg.1

− 1.216418

0.00422

Down

TC01005274.hg.1

− 1.212808

0.004223

Down

TC17001702.hg.1

− 1.257121

0.004264

Down

TC07002787.hg.1

− 1.2704

0.004275

Down

TC11001982.hg.1

− 1.215692

0.004283

Down

TC11002457.hg.1

− 1.224026

0.004285

Down

TC21000490.hg.1

− 1.222362

0.004298

Down

TC02001213.hg.1

− 1.275065

0.004309

Down

TC05002802.hg.1

− 1.454294

0.004316

Down

TC02002613.hg.1

− 1.202558

0.004342

Down

TC07002265.hg.1

− 1.303624

0.00435

Down

TC05002711.hg.1

− 1.278714

0.00436

Down

TC09000458.hg.1

− 1.295586

0.004368

Down

TC15001598.hg.1

− 1.273945

0.004373

Down

TC08000107.hg.1

− 1.284986

0.004389

Down

TC12002849.hg.1

− 1.258618

0.004394

Down

TC06002956.hg.1

− 1.208955

0.004397

Down

TC10000426.hg.1

− 1.257512

0.004417

Down

TC07000389.hg.1

− 1.257421

0.004438

Down

TC16001097.hg.1

− 1.300925

0.004443

Down

TC07002791.hg.1

− 1.206028

0.004459

Down

TC19001288.hg.1

− 1.237947

0.004464

Down

TC16000146.hg.1

− 1.233673

0.004467

Down

TC01002560.hg.1

− 1.207402

0.004482

Down

TC10002728.hg.1

− 1.272287

0.004506

Down

TC12000184.hg.1

− 1.207964

0.004508

Down

TC10001956.hg.1

− 1.201634

0.004513

Down

TC10001530.hg.1

− 1.212456

0.00456

Down

TC17002899.hg.1

− 1.208538

0.004573

Down

TC0X000632.hg.1

− 1.3172

0.004581

Down

TC17001547.hg.1

− 1.20639

0.004589

Down

TC04000311.hg.1

− 1.204792

0.004599

Down

TC20001506.hg.1

− 1.26979

0.004609

Down

TC06004015.hg.1

− 1.26321

0.004612

Down

TC01004440.hg.1

− 1.222055

0.004622

Down

TC01002542.hg.1

− 1.318907

0.004628

Down

TC18000718.hg.1

− 1.231172

0.004638

Down

TC04002390.hg.1

− 1.292294

0.004716

Down

TC04002908.hg.1

− 1.22141

0.004724

Down

TC01001491.hg.1

− 1.255189

0.004731

Down

TC19000841.hg.1

− 1.300943

0.004755

Down

TC01002756.hg.1

− 1.426354

0.00476

Down

TC20000309.hg.1

− 1.304516

0.004765

Down

TC11002990.hg.1

− 1.235653

0.00477

Down

TC03001403.hg.1

− 1.314851

0.004799

Down

TC06003498.hg.1

− 1.355157

0.004802

Down

TC09002774.hg.1

− 1.224146

0.00482

Down

TC10000250.hg.1

− 1.330922

0.004846

Down

TC16000333.hg.1

− 1.201118

0.004848

Down

TC22001283.hg.1

− 1.280786

0.004859

Down

TC10001915.hg.1

− 1.228546

0.004864

Down

TC11000196.hg.1

− 1.265687

0.004869

Down

TC02004125.hg.1

− 1.231632

0.004898

Down

TC15002307.hg.1

− 1.255684

0.0049

Down

TC03003205.hg.1

− 1.249546

0.004913

Down

TC01002776.hg.1

− 1.316093

0.004939

Down

TC03001745.hg.1

− 1.299476

0.004944

Down

TC06003126.hg.1

− 1.286256

0.004952

Down

TC01002773.hg.1

− 1.218511

0.004965

Down

TC02002927.hg.1

− 1.311688

0.004983

Down

TC01004326.hg.1

− 1.204881

0.004986

Down

TC21000729.hg.1

− 1.200973

0.004988

Down

TC22000110.hg.1

− 1.205007

0.004999

Down

TC09001132.hg.1

− 1.271309

0.005012

Down

TC10000232.hg.1

− 1.248461

0.005017

Down

TC05003302.hg.1

− 1.255306

0.005019

Down

TC20001224.hg.1

− 1.32063

0.005025

Down

TC01005383.hg.1

− 1.256589

0.005027

Down

TC0X001718.hg.1

− 1.226406

0.00504

Down

TC14000707.hg.1

− 1.204295

0.005058

Down

TC14001715.hg.1

− 1.346526

0.005061

Down

TC07002764.hg.1

− 1.200408

0.005079

Down

TC06003509.hg.1

− 1.230654

0.005084

Down

TC05002436.hg.1

− 1.273183

0.005118

Down

TC05000078.hg.1

− 1.23626

0.005121

Down

TC01006128.hg.1

− 1.328935

0.005126

Down

TC06003211.hg.1

− 1.277803

0.005157

Down

TC10000904.hg.1

− 1.247917

0.00516

Down

TC01001668.hg.1

− 1.212246

0.005206

Down

TC21000493.hg.1

− 1.236162

0.005232

Down

TC09000456.hg.1

− 1.266448

0.00524

Down

TC09002485.hg.1

− 1.263839

0.005256

Down

TC20001556.hg.1

− 1.279838

0.005284

Down

TC02002768.hg.1

− 1.253353

0.005287

Down

TC10002113.hg.1

− 1.217268

0.005328

Down

TC12001434.hg.1

− 1.297937

0.005333

Down

TC05001581.hg.1

− 1.260177

0.005344

Down

TC15002099.hg.1

− 1.266836

0.005352

Down

TC10001912.hg.1

− 1.349501

0.005391

Down

TC11002900.hg.1

− 1.284679

0.005393

Down

TC01005460.hg.1

− 1.207368

0.005401

Down

TC02001846.hg.1

− 1.402528

0.005406

Down

TC09000907.hg.1

− 1.24214

0.005409

Down

TC0X001572.hg.1

− 1.33578

0.005411

Down

TC09001363.hg.1

− 1.240359

0.005414

Down

TC10001686.hg.1

− 1.295313

0.005458

Down

TC08000285.hg.1

− 1.288083

0.005468

Down

TC07000767.hg.1

− 1.290819

0.005474

Down

TC13000606.hg.1

− 1.330779

0.005479

Down

TC04001792.hg.1

− 1.242708

0.005481

Down

TC02003857.hg.1

− 1.268582

0.005492

Down

TC01003317.hg.1

− 1.440286

0.005531

Down

TC12000588.hg.1

− 1.213828

0.005541

Down

TC20001554.hg.1

− 1.207139

0.005544

Down

TC07001657.hg.1

− 1.419211

0.005577

Down

TC09002148.hg.1

− 1.279893

0.00559

Down

TC15001221.hg.1

− 1.210747

0.005658

Down

TC11001828.hg.1

− 1.200582

0.00566

Down

TC13000062.hg.1

− 1.283458

0.005697

Down

TC05001353.hg.1

− 1.216892

0.005699

Down

TC01004219.hg.1

− 1.205464

0.005702

Down

TC01005835.hg.1

− 1.269379

0.005725

Down

TC06000930.hg.1

− 1.262508

0.00573

Down

TC03002911.hg.1

− 1.233783

0.005749

Down

TC02000415.hg.1

− 1.219812

0.005759

Down

TC11003125.hg.1

− 1.221046

0.005764

Down

TC01000579.hg.1

− 1.203049

0.005803

Down

TC14001295.hg.1

− 1.214363

0.005808

Down

TC05002238.hg.1

− 1.208419

0.005837

Down

TC04000662.hg.1

− 1.270677

0.005852

Down

TC02002347.hg.1

− 1.22743

0.005858

Down

TC17000164.hg.1

− 1.280195

0.005871

Down

TC08001315.hg.1

− 1.408884

0.005894

Down

TC03000982.hg.1

− 1.239878

0.005896

Down

TC11002959.hg.1

− 1.229904

0.005933

Down

TC14001177.hg.1

− 1.267289

0.005938

Down

TC11003265.hg.1

− 1.234478

0.005943

Down

TC01005831.hg.1

− 1.322234

0.005946

Down

TC09001793.hg.1

− 1.214475

0.005951

Down

TC01003533.hg.1

− 1.45726

0.00598

Down

TC06002968.hg.1

− 1.357034

0.00599

Down

TC0X000285.hg.1

− 1.203534

0.006068

Down

TC03003239.hg.1

− 1.234383

0.006086

Down

TC01004831.hg.1

− 1.238529

0.006107

Down

TC22001104.hg.1

− 1.213074

0.00614

Down

TC20001570.hg.1

− 1.20816

0.006172

Down

TC05000703.hg.1

− 1.311244

0.006174

Down

TC18000785.hg.1

− 1.224874

0.006179

Down

TC09002372.hg.1

− 1.257884

0.006182

Down

TC04000837.hg.1

− 1.230161

0.006195

Down

TC11000065.hg.1

− 1.217834

0.006275

Down

TC21000071.hg.1

− 1.206307

0.00628

Down

TC13001054.hg.1

− 1.273984

0.006291

Down

TC02003343.hg.1

− 1.214008

0.00634

Down

TC12002692.hg.1

− 1.289651

0.006353

Down

TC01005539.hg.1

− 1.21791

0.006371

Down

TC07000299.hg.1

− 1.266678

0.006379

Down

TC12000625.hg.1

− 1.265515

0.006384

Down

TC09002445.hg.1

− 1.334389

0.006413

Down

TC05001346.hg.1

− 1.231796

0.006493

Down

TC12001821.hg.1

− 1.242271

0.006511

Down

TC08000954.hg.1

− 1.26309

0.00655

Down

TC12000683.hg.1

− 1.311043

0.006566

Down

TC17002263.hg.1

− 1.2066

0.006574

Down

TC01001760.hg.1

− 1.277558

0.006592

Down

TC17000557.hg.1

− 1.322598

0.006597

Down

TC20001196.hg.1

− 1.31133

0.0066

Down

TC04001967.hg.1

− 1.290136

0.006618

Down

TC14000795.hg.1

− 1.300583

0.006633

Down

TC12000745.hg.1

− 1.336139

0.006672

Down

TC17001160.hg.1

− 1.232074

0.006688

Down

TC09002037.hg.1

− 1.25914

0.006701

Down

TC07000189.hg.1

− 1.284554

0.006711

Down

TC10002162.hg.1

− 1.331341

0.006729

Down

TC10001758.hg.1

− 1.33558

0.006732

Down

TC6_ssto_hap7000179.hg.1

− 1.266774

0.006776

Down

TC05001609.hg.1

− 1.219982

0.006802

Down

TC09000397.hg.1

− 1.208158

0.006825

Down

TC01000008.hg.1

− 1.260407

0.006838

Down

TC05002179.hg.1

− 1.24681

0.006955

Down

TC06003468.hg.1

− 1.237969

0.007002

Down

TC07000766.hg.1

− 1.246781

0.007038

Down

TC03002074.hg.1

− 1.286913

0.007049

Down

TC06002573.hg.1

− 1.200492

0.007087

Down

TC17002315.hg.1

− 1.224284

0.007119

Down

TC17002681.hg.1

− 1.215864

0.007147

Down

TC08002507.hg.1

− 1.219674

0.007209

Down

TC07001642.hg.1

− 1.262919

0.007238

Down

TC04002802.hg.1

− 1.281658

0.007272

Down

TC07000507.hg.1

− 1.319983

0.007285

Down

TC03000233.hg.1

− 1.267284

0.0073

Down

TC17000344.hg.1

− 1.230796

0.007318

Down

TC10000974.hg.1

− 1.235907

0.007324

Down

TC01002173.hg.1

− 1.204552

0.007339

Down

TC03000641.hg.1

− 1.205138

0.007362

Down

TC01004748.hg.1

− 1.265677

0.007451

Down

TC11001732.hg.1

− 1.382737

0.007461

Down

TC07002298.hg.1

− 1.229053

0.007471

Down

TC02000198.hg.1

− 1.241303

0.007479

Down

TC19000822.hg.1

− 1.291223

0.007487

Down

TC05002943.hg.1

− 1.222683

0.00749

Down

TC05000859.hg.1

− 1.310438

0.007529

Down

TC01006140.hg.1

− 1.291211

0.00756

Down

TC02001517.hg.1

− 1.226001

0.007575

Down

TC02001732.hg.1

− 1.211515

0.007601

Down

TC17002605.hg.1

− 1.203515

0.007619

Down

TC02004353.hg.1

− 1.446996

0.007622

Down

Probe set ID

Fold change

p-value

Gene feature

(C) Genes up/down-regulated in non-purified lung TCsSV40 compared with non-purified primary lung TCs

TC03003114.hg.1

4.734104

2.70E−05

Up

TC17001801.hg.1

− 2.581599

3.00E−05

Down

TC11002894.hg.1

3.769187

3.20E−05

Up

TC04000160.hg.1

− 2.019509

3.50E−05

Down

TC20000952.hg.1

− 2.001725

3.80E−05

Down

TC04002890.hg.1

2.318185

4.00E−05

Up

TC11003109.hg.1

5.927567

4.30E−05

Up

TC02000205.hg.1

− 1.864365

4.50E−05

Down

TC12000558.hg.1

− 1.77743

4.80E−05

Down

TC09000971.hg.1

− 1.924593

5.10E−05

Down

TC0X001292.hg.1

− 3.110776

5.30E−05

Down

TC08000385.hg.1

− 1.758147

5.60E−05

Down

TC02004814.hg.1

− 1.730004

5.80E−05

Down

TC06001978.hg.1

− 2.037057

6.10E−05

Down

TC12001286.hg.1

− 1.823703

6.40E−05

Down

TC08000302.hg.1

− 2.018038

6.60E−05

Down

TC07001784.hg.1

− 1.938506

6.90E−05

Down

TC12000927.hg.1

− 2.156997

7.10E−05

Down

TC15000452.hg.1

− 2.013654

7.40E−05

Down

TC11002382.hg.1

− 3.896927

7.70E−05

Down

TC02001940.hg.1

− 1.982875

7.90E−05

Down

TC09001648.hg.1

− 2.074788

8.20E−05

Down

TC02001602.hg.1

− 1.697784

8.40E−05

Down

TC06000639.hg.1

− 2.003858

8.70E−05

Down

TC04002560.hg.1

2.166732

9.00E−05

Up

TC17001773.hg.1

− 1.582128

9.20E−05

Down

TC13000783.hg.1

− 2.527727

9.50E−05

Down

TC0X001624.hg.1

− 1.937361

9.70E−05

Down

TC05001593.hg.1

− 1.926476

1.00E−04

Down

TC19001567.hg.1

1.692676

0.000103

Up

TC02002456.hg.1

− 1.806913

0.000105

Down

TC08002421.hg.1

− 2.163126

0.000108

Down

TC09001898.hg.1

− 1.436061

0.00011

Down

TC0X000450.hg.1

− 1.484801

0.000113

Down

TC02003744.hg.1

1.585428

0.000116

Up

TC07002463.hg.1

1.777811

0.000118

Up

TC07001655.hg.1

− 1.503467

0.000121

Down

TC22000156.hg.1

1.898289

0.000123

Up

TC16000648.hg.1

− 2.164873

0.000126

Down

TC04002642.hg.1

− 1.587573

0.000129

Down

TC16001289.hg.1

− 1.766618

0.000131

Down

TC06000568.hg.1

− 1.73117

0.000134

Down

TC20000650.hg.1

− 1.835321

0.000136

Down

TC0X001889.hg.1

1.580745

0.000139

Up

TC04001945.hg.1

− 1.643053

0.000142

Down

TC11001010.hg.1

− 1.603866

0.000144

Down

TC03001841.hg.1

− 1.766003

0.000147

Down

TC05003313.hg.1

1.920567

0.000149

Up

TC05001142.hg.1

− 1.371777

0.000152

Down

TC02000396.hg.1

− 1.829949

0.000155

Down

TC12000231.hg.1

− 1.550803

0.000157

Down

TC17000491.hg.1

− 1.592587

0.00016

Down

TC0X001430.hg.1

− 1.820415

0.000162

Down

TC16002030.hg.1

− 1.524415

0.000165

Down

TC02001836.hg.1

− 1.49041

0.000168

Down

TC07002531.hg.1

1.715119

0.00017

Up

TC17002479.hg.1

1.76047

0.000173

Up

TC04001635.hg.1

− 2.303785

0.000175

Down

TC01003308.hg.1

− 1.900128

0.000178

Down

TC08002253.hg.1

− 2.893756

0.000181

Down

TC06000705.hg.1

− 1.731076

0.000183

Down

TC08000801.hg.1

− 1.729942

0.000186

Down

TC15001184.hg.1

− 1.439815

0.000188

Down

TC0X001410.hg.1

− 1.581381

0.000191

Down

TC16001066.hg.1

− 1.31385

0.000194

Down

TC0X001822.hg.1

1.439398

0.000196

Up

TC22001175.hg.1

− 1.542513

0.000199

Down

TC05002512.hg.1

− 1.48484

0.000201

Down

TC12001449.hg.1

− 1.863709

0.000204

Down

TC01001501.hg.1

− 1.466269

0.000207

Down

TC20000373.hg.1

− 1.596942

0.000209

Down

TC01003990.hg.1

− 1.514826

0.000212

Down

TC09000096.hg.1

− 1.937731

0.000214

Down

TC06000824.hg.1

− 1.586137

0.000217

Down

TC10002723.hg.1

− 1.693797

0.00022

Down

TC06004042.hg.1

− 1.463012

0.000222

Down

TC19000767.hg.1

− 1.80746

0.000225

Down

TC15001604.hg.1

− 1.573292

0.000227

Down

TC0X000985.hg.1

− 2.24906

0.00023

Down

TC0X001210.hg.1

− 1.648953

0.000233

Down

TC08002510.hg.1

2.254553

0.000235

Up

TC12000633.hg.1

− 1.764414

0.000238

Down

TC06003416.hg.1

− 1.389758

0.00024

Down

TC09000963.hg.1

− 1.4781

0.000243

Down

TC15001326.hg.1

− 1.537491

0.000246

Down

TC01004763.hg.1

1.400232

0.000248

Up

TC12002858.hg.1

1.534662

0.000251

Up

TC05002279.hg.1

− 1.509417

0.000253

Down

TC0X001136.hg.1

− 1.444487

0.000256

Down

TC08000652.hg.1

− 1.577232

0.000259

Down

TC11002486.hg.1

− 1.651639

0.000261

Down

TC07003059.hg.1

1.417719

0.000264

Up

TC02000955.hg.1

− 1.666162

0.000266

Down

TC14001892.hg.1

− 1.606681

0.000269

Down

TC17001656.hg.1

− 1.472658

0.000272

Down

TC06002227.hg.1

− 1.627176

0.000274

Down

TC05000998.hg.1

− 1.408795

0.000277

Down

TC09001602.hg.1

− 1.887078

0.000279

Down

TC09001534.hg.1

− 1.467576

0.000282

Down

TC02004275.hg.1

− 1.320789

0.000285

Down

TC17000728.hg.1

− 2.065452

0.000287

Down

TC06000725.hg.1

1.440025

0.00029

Up

TC10002919.hg.1

− 1.600614

0.000292

Down

TC12000805.hg.1

− 1.56655

0.000295

Down

TC10000686.hg.1

− 1.469338

0.000298

Down

TC0X001158.hg.1

− 1.926968

3.00E−04

Down

TC09001936.hg.1

− 1.453724

0.000303

Down

TC16001498.hg.1

1.666085

0.000305

Up

TC12002493.hg.1

1.355038

0.000308

Up

TC10000439.hg.1

− 1.562003

0.000311

Down

TC0X001411.hg.1

− 1.587704

0.000313

Down

TC10000866.hg.1

− 1.575569

0.000318

Down

TC05002034.hg.1

− 1.483066

0.000321

Down

TC0Y000064.hg.1

1.420454

0.000325

Up

TC0Y000173.hg.1

1.420454

0.000325

Up

TC08001864.hg.1

2.861562

0.000329

Up

TC19000163.hg.1

− 1.609154

0.000331

Down

TC09000516.hg.1

− 1.559053

0.000334

Down

TC14002059.hg.1

1.551644

0.000337

Up

TC11002784.hg.1

1.820896

0.000339

Up

TC07002052.hg.1

− 1.561394

0.000342

Down

TC03002116.hg.1

− 1.474893

0.000344

Down

TC11002476.hg.1

− 1.57355

0.000347

Down

TC06002303.hg.1

− 1.518545

0.00035

Down

TC14001731.hg.1

1.403751

0.000352

Up

TC04002294.hg.1

− 1.448062

0.000355

Down

TC01003510.hg.1

− 1.493469

0.000357

Down

TC05001562.hg.1

− 1.537085

0.00036

Down

TC01002976.hg.1

− 1.566265

0.000362

Down

TC02001432.hg.1

− 1.55349

0.000365

Down

TC16001854.hg.1

− 1.350821

0.000368

Down

TC21000698.hg.1

− 1.401198

0.00037

Down

TC03000195.hg.1

− 1.616867

0.000373

Down

TC06001651.hg.1

− 1.50443

0.000375

Down

TC06001365.hg.1

− 1.809445

0.000378

Down

TC07001706.hg.1

− 1.618734

0.000382

Down

TC07001709.hg.1

− 1.618734

0.000382

Down

TC15002247.hg.1

1.354504

0.000386

Up

TC21000931.hg.1

− 1.420416

0.000391

Down

TC04002443.hg.1

− 1.551184

0.000394

Down

TC09000586.hg.1

− 1.554678

0.000396

Down

TC14000620.hg.1

− 1.494772

0.000399

Down

TC06002402.hg.1

1.646644

0.000401

Up

TC12000088.hg.1

1.444149

0.000404

Up

TC01002798.hg.1

− 1.895656

0.000407

Down

TC05002818.hg.1

− 1.513562

0.000409

Down

TC03001056.hg.1

− 1.606915

0.000412

Down

TC01002746.hg.1

− 1.453698

0.000414

Down

TC02003041.hg.1

− 1.421703

0.000417

Down

TC04000811.hg.1

− 1.391548

0.00042

Down

TC09002304.hg.1

− 1.275207

0.000422

Down

TC05002800.hg.1

− 1.443218

0.000425

Down

TC03003057.hg.1

1.435368

0.000427

Up

TC11002810.hg.1

1.338827

0.00043

Up

TC08002059.hg.1

1.653874

0.000433

Up

TC0X002006.hg.1

− 1.347272

0.000435

Down

TC04001524.hg.1

− 1.559985

0.000438

Down

TC22001053.hg.1

− 1.465136

0.00044

Down

TC05000688.hg.1

− 1.557631

0.000443

Down

TC08002396.hg.1

− 1.266228

0.000446

Down

TC03001571.hg.1

− 1.575772

0.000448

Down

TC09002074.hg.1

1.663248

0.000451

Up

TC18000864.hg.1

1.491055

0.000453

Up

TC02001429.hg.1

− 1.512663

0.000456

Down

TC22000400.hg.1

− 1.474029

0.000459

Down

TC04001675.hg.1

1.523103

0.000461

Up

TC05000183.hg.1

− 1.591351

0.000466

Down

TC08000450.hg.1

− 1.754444

0.000469

Down

TC22001417.hg.1

− 1.575065

0.000477

Down

TC16001991.hg.1

− 1.30884

0.000479

Down

TC02004784.hg.1

− 1.291479

0.000482

Down

TC12003094.hg.1

− 1.450031

0.000487

Down

TC05002434.hg.1

1.258242

0.00049

Up

TC06002096.hg.1

− 1.459176

0.000492

Down

TC09000471.hg.1

− 1.399173

0.000495

Down

TC08002500.hg.1

− 1.277475

0.000498

Down

TC21000887.hg.1

1.340516

5.00E−04

Up

TC04001473.hg.1

− 1.527189

0.000503

Down

TC01000642.hg.1

− 1.492463

0.000505

Down

TC07001788.hg.1

− 1.686158

0.000508

Down

TC02003970.hg.1

− 1.440374

0.000511

Down

TC07000478.hg.1

− 1.476748

0.000513

Down

TC01005360.hg.1

1.315026

0.000516

Up

TC08002335.hg.1

− 1.716035

0.000518

Down

TC14002181.hg.1

− 1.260915

0.000521

Down

TC01002620.hg.1

− 1.443838

0.000526

Down

TC16001156.hg.1

− 1.403474

0.000531

Down

TC11001288.hg.1

− 1.336498

0.000534

Down

TC12003194.hg.1

− 1.56187

0.000537

Down

TC0X002258.hg.1

− 1.47544

0.000539

Down

TC05001001.hg.1

− 1.403589

0.000542

Down

TC04002346.hg.1

1.340139

0.000544

Up

TC06002606.hg.1

− 1.808218

0.000547

Down

TC14000667.hg.1

1.35603

0.00055

Up

TC03003257.hg.1

− 1.541547

0.000552

Down

TC13001029.hg.1

1.266449

0.000555

Up

TC01006195.hg.1

− 1.266774

0.000557

Down

TC12001995.hg.1

− 1.530295

0.00056

Down

TC12001434.hg.1

− 1.326576

0.000563

Down

TC10000232.hg.1

− 1.308551

0.000565

Down

TC03003056.hg.1

1.356981

0.000568

Up

TC01006074.hg.1

− 1.330658

0.00057

Down

TC11003147.hg.1

− 1.269907

0.000573

Down

TC03002679.hg.1

1.353352

0.000576

Up

TC0X001094.hg.1

− 1.384223

0.000578

Down

TC09002823.hg.1

1.490093

0.000581

Up

TC13001025.hg.1

1.345303

0.000586

Up

TC09000043.hg.1