- Research
- Open Access
Methylation of miR-34a, miR-34b/c, miR-124-1 and miR-203 in Ph-negative myeloproliferative neoplasms
https://doi.org/10.1186/1479-5876-9-197
© Chim et al; licensee BioMed Central Ltd. 2011
- Received: 7 April 2011
- Accepted: 14 November 2011
- Published: 14 November 2011
Abstract
Background
MicroRNA (miR) miR-34 a, -34b/c, -124-1 and -203 are tumor suppressor miRs implicated in carcinogenesis.
Methods
We studied DNA methylation of these miRs in Philadelphia-negative (Ph-ve) myeloproliferative neoplasms (MPNs). Methylation-specific PCR (MSP), verified by direct sequencing of the methylated MSP products, was performed in cell lines, normal controls and diagnostic marrow samples of patients with MPNs.
Results
Methylation of these miRs was absent in the normal controls. miR-34b/c were homozygously methylated in HEL cells but heterozygously in MEG-01. In HEL cells, homozygous miR-34b/c methylation was associated with miR silencing, and 5-aza-2'-deoxycytidine treatment led to re-expression of both miR-34b and miR-34c, consistent with that both miRs are under the regulation of the same promoter CpG island. miR-34a was heterozygously methylated in MEG-01 and K-562. miR-203 was completely unmethylated in K-562 and SET-2 but no MSP amplification was found in both HEL and MEG-01, suggestive of miR deletion. In primary samples, four each had miR-34b/c and -203 methylation, in which two had concomitant methylation of miR-34b/c and -203. miR-34a was methylated in one patient and none had methylation of miR-124-1. Seven patients (15.6%) had methylation of at least one of the four miRs. miR methylation did not correlate with clinical parameters, disease complications or JAK2 V617F mutation.
Conclusion
This is the first report of miR hypermethylation in MPNs. miR-203 hypermethylation is not specific to Ph+ve leukemias but also present in Ph-ve MPNs. miR-34b/c methylation was associated with reversible miR silencing. There was no correlation of miR methylation with clinical demographic data or outcome.
Keywords
- microRNA
- tumor suppressor
- hypermethylation
- Ph-negative myeloproliferative neoplasm
Background
Philadelphia-negative (Ph-ve) myeloproliferative neoplasm (MPN) is a stem cell disease with proliferation of myeloid lineage, leading to the development of distinct clinical entities including polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (PMF) [1–3]. JAK2 V617F mutation, resulting in constitutive activation of JAK-STAT signaling, occurs in about half of the patients with ET and PMF but in more than 90% of patients with PV [1].
Gene methylation is an alternative mechanism of gene inactivation, and various tumor suppressor genes regulating the cell cycle, apoptosis and cell signaling have been shown to be hypermethylated in hematological malignancies [4].
MicroRNA (miR) is a single-stranded, non-coding RNA molecule of 22-25 nucleotides, which leads to downregulation of target protein expression [5]. miRs are involved in carcinogenesis [6]. miRs can be either oncogenic (oncomir) when tumor suppressor genes (TSG) are targeted, or tumor suppressive (tumor suppressor miRs) when oncogenes are targeted [7].
Recently, miR-34a, miR-34b/c, miR-124-1 and miR-203 hypermethylation have been implicated in carcinogenesis. Hypermethylation of miR-34a, a transcriptional target of p53, has been demonstrated in solid and hematopoietic cancers [8, 9], whereas restoration of which will inhibit CDK6 translation by complementary binding to the 3' untranslated region (3' UTR) of the CDK6 mRNA and induce apoptosis, thereby showing the tumor suppressor role of miR-34a[8]. Epigenetic inactivation of miR-34b, another p53 downstream target of the miR-34 family, has also been implicated in acute myeloid leukemia (AML), and the re-expression of miR-34b led to suppression of CREB expression and inhibition of cell proliferation [10]. Promoter methylation of miR-124-1, the first tumor suppressor miR found to be regulated by DNA methylation, has been shown to confer poor prognosis of acute lymphoblastic leukemia (ALL) [11]. Moreover, hypermethylation of miR-203 has been reported in chronic myeloid leukemia (CML), conferring a proliferative advantage to the tumor cells by inhibiting the oncogenic BCR-ABL fusion protein [12]. In Ph-ve MPN, little is known about the epigenetic alteration of miR methylation. In this report, we studied the methylation status of miR-34a, miR-34b/c, miR-124-1 and miR-203 in PV, ET and PMF.
Methods
Patient samples
Patient demographic data and status of microRNA methylation
sex | age | Diagnosis | Symptoms at diagnosis | myeloid transformation | JAK2 V617F mutation | miR-34b/c | miR-34a | miR-203 | miR-124-1 |
---|---|---|---|---|---|---|---|---|---|
F | 78 | ET | Epigastric pain | No | yes | U | U | M | U |
F | 81 | ET | Epigastric pain | No | yes | U | U | U | U |
M | 32 | ET | erythromelalgia | No | yes | U | U | U | U |
M | 81 | ET | N/A | No | yes | U | U | U | U |
M | 59 | ET | N/A | N/A (No record) | yes | M | U | U | U |
M | 76 | ET | Nil | No | yes | U | M | U | U |
M | 53 | ET | Nil | MDS | yes | U | U | U | U |
F | 89 | ET | Nil | N/A (No record) | yes | U | U | U | U |
F | 43 | ET | Nil | N/A (No record) | yes | M | U | M | U |
F | 82 | ET | Nil | No | yes | U | U | U | U |
M | 78 | ET | Nil | No | yes | U | U | U | U |
F | 79 | ET | Nil | No | yes | U | U | U | U |
M | 84 | ET | Nil | AML | yes | U | U | U | U |
F | 74 | ET | Nil | No | yes | M | U | M | U |
F | 56 | ET | Nil | No | yes | U | U | U | U |
M | 60 | ET | Nil | No | N/A | U | U | U | U |
M | 68 | ET | Nil | AML | yes | U | U | U | U |
M | 39 | ET | Nil | No | yes | U | U | U | U |
F | 79 | ET | Weight loss | No | yes | U | U | U | U |
F | 60 | ET | erythromelalgia | No | no | U | U | U | U |
M | 63 | ET | Minor stroke (LUL numbness) | No | no | U | U | U | U |
M | 47 | ET | erythromelalgia | No | no | U | U | U | U |
F | 62 | ET | erythromelalgia, Headache | No | no | U | U | U | U |
F | 83 | ET | N/A | N/A (No record) | no | U | U | M | U |
F | 32 | ET | Nil | N/A (No record) | no | U | U | U | U |
F | 42 | ET | Nil | No | no | M | U | U | U |
M | 85 | ET | Nil | No | no | U | U | U | U |
M | 71 | ET | Nil | No | no | U | U | U | U |
F | 28 | ET | Nil | No | no | U | U | U | U |
F | 87 | ET | Nil | No | no | U | U | U | U |
M | 48 | ET | Nil | No | no | U | U | U | U |
M | 48 | ET | Nil | No | no | U | U | U | U |
M | 41 | ET | epistaxis | No | N/A | U | U | U | U |
M | 82 | ET | N/A | No | N/A | U | U | U | U |
F | 41 | PMF | Easy bruising | N/A (No record) | yes | U | U | U | U |
M | 67 | PMF | Nil | No | yes | U | U | U | U |
F | 82 | PMF | Nil | No | yes | U | U | U | U |
F | 42 | PV | Minor stroke (RUL paraesthesia) | No | yes | U | U | U | U |
M | 48 | PV | Gum bleeding | No | yes | U | U | U | U |
F | 75 | PV | Nil | AML | yes | U | U | U | U |
M | 78 | PV | Nil | No | yes | U | U | U | U |
M | 57 | PV | Visual blurring (BRAO) | No | yes | U | U | U | U |
M | 44 | PV | abdominal pain (splenic infarction) | No | no | U | U | U | U |
M | 71 | PV | Gum bleeding | MDS | N/A | U | U | U | U |
F | 77 | PV | N/A | No | N/A | U | U | U | U |
Cell lines and culture
MEG-01 and K-562 cells were kindly provided by Dr Mo Yang, Department of Paediatrics, Queen Mary Hospital, The University of Hong Kong, Hong Kong. HEL cells were obtained from Dr Dong-Er Zhang, Department of Pathology and Molecular Biology, Moores Cancer Center, University of California San Diego, USA. SET-2 cells were purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DMSZ) (Braunschweig, Germany). SET-2 was derived from ET at megakaryoblastic leukemic transformation. HEL was derived from AML M6. Both SET-2 and HEL cells carry JAK2 V617F mutation. MEG-01 and K-562 were derived from blastic transformation of patients with CML. Cell cultures were maintained in RPMI media 1640 (Invitrogen, Carlsbad, CA), supplemented with 10% (20% for SET-2) fetal bovine serum (Invitrogen, Carlsbad, CA), 50 U/ml penicillin, and 50 μg/ml streptomycin (Invitrogen, Carlsbad, CA) in a humidified atmosphere of 5% CO2 at 37°C.
Methylation-specific polymerase chain reaction (MSP)
MSP primer sequences and reaction conditions
Gene | Forward primer (5' - 3') | Reverse primer (5' - 3') | MgCl2/Tm/Cycles | Reference |
---|---|---|---|---|
miR-34a | ||||
M-MSP | GGGGATGAGGATTAGGATTTC | ACAAAACGCATAAAAACGACG | 1.5 mM/58°C/35 | [9] |
U-MSP | GGGGATGAGGATTAGGATTTT | CAAACAAAACACATAAAAACAACA | 1.5 mM/58°C/35 | |
miR-34b/c | ||||
M-MSP | ATTCGTTTCGTTTCGCGTTCGTTTC | CGACTACAACTCCCGAACGATCCG | 2.0 mM/58°C/35 | |
U-MSP | TTTTTATTTGTTTTGTTTTGTGTTTGTTTTG | CAACTACAACTCCCAAACAATCC | 1.25 mM/56°C/38 | |
miR-124-1 | ||||
M-MSP | AAAGAGTTTTTGGAAGACGTC | AATAAAAAACGACGCGTATA | 1.5 mM/55°C/35 | [36] |
U-MSP | AATAAAGAGTTTTTGGAAGATGTT | AAAAAAATAAAAAACAACACATATAC | 2.0 mM/55°C/35 | |
miR-203 | ||||
M-MSP | GAGTATTTTCGGTTTAGACGAGAC | CCTTTTATACGACGCAACCG | 1.5 mM/58°C/35 | [37] |
U-MSP | TTTGAGTATTTTTGGTTTAGATGAGAT | AACACCTTTTATACAACACAACCA | 1.5 mM/58°C/35 |
5-aza-2'-deoxycytidine (5-AzadC) treatment
HEL cells were homozygously methylated for miR-34b/c. Cells were seeded in six-well plates at a density of 1 × 106 cells/ml, and cultured with 1.5 μM of 5-AzadC for 7 days. Cells on day 0 and day 7 of treatment were harvested.
RNA isolation and stem-loop reverse transcription-polymerase chain reaction (RT-PCR)
Total RNA was isolated using mir Vana™ miRNA Isolation Kit (Ambion, Austin, TX), according to the manufacturer's instructions. RT was performed using Taqman® MicroRNA RT Kit and Taqman® MicroRNA Assay Kit (Applied Biosciences, Foster City, CA), according to the manufacturer's instructions. Total RNA was reverse transcribed in 1 mM dNTPs, 50 U MultiScribe™ Reverse Transcriptase, 1X RT Buffer, 3.8 U RNase Inhibitor, and 1X stem-loop RT primer at the following thermal cycling condition: 16°C for 30 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. Quantitative real-time PCR was performed using 1.33 μl of 1:15 diluted RT product in 1X Taqman® Universal PCR Master Mix, and 1X Taqman® Assay at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. RNU48 was used as reference for data analysis using the 2-ΔΔCt method [15]. Conventional RT-PCR for primary miR-34a was performed as previously described [9].
Statistical analysis
Correlation between combined miR methylation status (i.e. those with methylation of any of these four miRs) with categorical variables (gender, MPN subtype, occurrence of myeloid transformation, development of thrombosis [either at diagnosis or after diagnosis of MPN] and presence of JAK2 V617F mutation) and continuous variables (age, presenting Hb, leukocyte and platelet counts) was computed by the Chi-square test (or Fisher Exact test) and Student's T-test. All p-values were two-sided.
Results
MSP
Controls
Methylation of miR-34a , miR-34b/c , miR-124-1 and miR-203. A) Sequence analysis of the M-MSP product from bisulfite-treated positive control DNA showed that the cytosine [C] residues of CpG dinucleotides were methylated and remained unchanged, whereas all the other C residues were unmethylated and were converted to thymidine [T], confirming complete bisulfite conversion and MSP specificity. B) M-/U-MSP analysis showed that all the eight normal controls [N1-N8] were unmethylated. C) In the cell lines, MEG-01 and K-562 were hemizygously methylated for miR-34a; HEL was completely methylated, MEG-01 was hemizygously methylated for miR-34b/c; all the four cell lines were unmethylated for miR-124-1; K-562 and SET-2 were completely unmethylated for miR-203.
Cell lines
MSP of miRs in cell lines
miR-34a | miR-34b/c | miR-124-1 | miR-203 | |
---|---|---|---|---|
Chromosomal location of miR | 1p36 | 11q23 | 8p23 | 14q32 |
HEL | UU | MM | UU | -/- |
MEG-01 | UM | UM | UU | -/- |
K-562 | UM | UU | UU | UU |
SET-2 | UU | UU | UU | UU |
Primary samples
Methylation of miR-34a , miR-34b/c , miR-124-1 and miR-203 in primary samples. For each of these miRs, M-/U-MSP and sequencing of the M-MSP product from representative bisulfite-treated primary samples were shown. In the sequence analysis of the M-MSP product, cytosine [C] residues of CpG dinucleotides were methylated and remained unchanged, partially methylated C residues were denoted as [C/T], unmethylated C residues were converted into [T], whereas all the non-CpG C residues were unmethylated and were converted to thymidine [T], confirming complete bisulfite conversion and MSP specificity.
5-AzadC treatment of HEL cells
Effect of 5-aza-2'-deoxycytidine (5-AzadC) treatment on HEL cells. A) M-/U-MSP analysis of miR-34b/c promoter methylation status showed that 5-AzadC treatment led to progressive demethylation of miR-34b/c promoter in HEL cells. B) Stem-loop qRT-PCR analysis of mature miR-34b and miR-34c expression in HEL cells seven days after treatments. Error bar represents standard deviation.
Discussion
Little information is available about the role of miRs in MPNs. Based on a literature search on the PubMed using keywords of "microRNA, methylation and myeloproliferative", no publication could be found. Therefore, this is likely the first report on methylation of miRs in MPN. In this study, we examined the methylation of miR-34a, -34b/c, -124-1 and -203 for a range of MPNs. In an attempt to identify miRs specifically involved in erythropoiesis, miR expression from in vitro expansion of erythroid cells derived from peripheral blood mononuclear cells were compared with controls, which showed miR-451 upregulation was specific to erythropoiesis [16]. On the other hand, during in vitro differentiation of megakaryocytes derived from CD34+ hematopoietic progenitors, downregulation of miR-10a, -10b, -17, -20, -106 and -126 was observed [17]. Moreover, when comparing the miR expression profiling of megakaryoblastic cell line with in vitro differentiated megakaryocytes, upregulation of miR-99a, -101, -126, and -135 was also found [17]. Therefore, the upregulation and downregulation of these specific miRs were associated with megakaryocytic and erythropoietic differentiation.
Despite that multiple TSGs were shown to be silenced by hypermethylation in AML [4, 14, 18–22], methylation of tumor suppressor genes was less frequently reported in MPN. Only recently, there were a few reports of methylation of the negative regulators of the JAK-STAT signaling pathway, SOCS1, SOCS2 and SOCS3, in Ph-ve MPN regardless of the JAK2 V617F mutation status [23–26].
Furthermore, based on previous work by us and others, CDK6 has been shown to be the target of multiple miRs including miR-34a, -34b/c and -124-1[27, 28]. Moreover, CREB is the target of miR-34b and -203[10, 29]. Finally, ABL is an additional target of miR-203[12]. Consequently, epigenetic silencing of tumor suppressor miR-34a, miR-34b/c, miR-124-1 and miR-203 will confer proliferative advantage to the tumor cells [27–29]. In contrast to a previous report which showed miR-203 was methylated in Ph+ve but not Ph-ve MPN or leukemia, using MSP primers in the similar region [12], we demonstrated that miR-203 was hypermethylated in primary MPN samples, which was further verified by direct sequencing of the methylated MSP products. Therefore, it would appear that miR-203 methylation is involved in a wider spectrum of MPNs or leukemias, regardless of their Ph chromosome status. Finally, while two patients had concomitant methylation of miR-203 and -34b/c, none had concomitant methylation of miR-34a and -34b/c, both transcriptional targets of p53, and hence avoiding duplication of tumor suppressor gene inactivation of the same pathway.
In HEL and MEG-01 cells, both U- and M-MSP signals of miR-203 were absent, which might be due to the following possibilities: (1) sample DNA degradation, (2) inappropriate PCR condition, or (3) homozygous deletion of the region. Since simultaneous U-MSP analysis of the same DNA sample for miR-34a, miR-34b/c, and miR-124-1 promoter successfully generated the U-MSP signals, hence the absence of MSP signals for miR-203 in HEL and MEG-01 cells could not be explained by a poor DNA quality. Moreover, as miR-203 U-MSP was successful in all the other samples including cell lines, normal controls, patient samples and methylated positive control, inappropriate MSP conditions appears unlikely. Therefore, the absence of both M- and U-MSP signals in HEL and MEG-01 cells might be caused by deletions of the region. However, karyotypic data of HEL and MEG-01 cells did not reveal homozygous deletion of 14q32, and hence whether absence of MSP amplification of miR-203 might be due to microdeletion of this region requires further study [30]. Furthermore, hypomethylation treatment of the HEL cells, which was homozygously methylated for the miR-34b/c, a microRNA cluster localized to 11q23, showed significant re-expression of mature miR-34b and miR-34c. This finding is consistent with that both miR-34b and miR-34c are under the promoter regulation of the same CpG island. By contrast, miR-34a, another member of the miR-34 family localized to 1p36, was not constitutively expressed. Moreover, hypomethylating treatment did not lead to expression of primary miR-34a, suggesting additional mechanism, possibly histone modification, in the regulation of miR-34a expression [9]. Furthermore, in addition to showing miR silencing in cell line, it is important to show the correlation of miR methylation and miR expression in the primary sample. In this connection, we shall collect both DNA and RNA from diagnostic bone marrow samples in the future.
In order to identify miRs that are methylated specifically at the time of transformation to AML or MDS, and hence implicated for pathogenesis of myeloid transformation, ideally one should analyze the paired marrow samples at both diagnosis and leukemic/myelodysplastic transformation. This is exemplified by our recent publication in the study of epigenetic inactivation of miR-34b/c methylation in myeloma, in which we showed that while miR-34b/c is not methylated at diagnosis, it is frequently methylated at the time of relapse or disease progression. This is as evidenced by the significantly more frequent methylation of miR-34b/c of myeloma samples at relapse in patients with both diagnostic and relapse marrow samples[31].
Finally, unlike the association of TSG with clinical parameters, such as the association of CDKN2B and WIF1 methylation with high presenting leukocyte count in acute promyelocytic leukemia [32, 33], methylation of these miRs did not correlate with demographic, presenting blood counts, JAK2 V617F mutation or complications including thrombosis and myeloid transformations.
Conclusion
This is the first report of miR hypermethylation in MPNs. miR-203 hypermethylation is not specific to Ph+ve leukemias but also present in Ph-ve MPNs. miR-34b/c methylation was associated with reversible miR silencing. There was no correlation of miR methylation with clinical demographic data or outcome.
Declarations
Authors’ Affiliations
References
- Tefferi A, Thiele J, Orazi A, Kvasnicka HM, Barbui T, Hanson CA, Barosi G, Verstovsek S, Birgegard G, Mesa R: Proposals and rationale for revision of the World Health Organization diagnostic criteria for polycythemia vera, essential thrombocythemia, and primary myelofibrosis: recommendations from an ad hoc international expert panel. Blood. 2007, 110: 1092-1097.View ArticlePubMedGoogle Scholar
- Chim CS, Kwong YL, Lie AKW, Ma SK, Chan CC, Wong LG, San Kho BC, Lee HK, Sim JPY, Chan CH: Long-term Outcome of 231 Patients With Essential Thrombocythemia: Prognostic Factors for Thrombosis, Bleeding, Myelofibrosis, and Leukemia. Arch Intern Med. 2005, 165: 2651-2658.View ArticlePubMedGoogle Scholar
- Chim CS, Kwong YL, Chan PT, Raymond L: Polycythemia vera in Chinese patients: Thirty-six years of experience. American Journal of Hematology. 1997, 56: 59-62.View ArticlePubMedGoogle Scholar
- Chim CS, Liang R, Kwong YL: Hypermethylation of gene promoters in hematological neoplasia. Hematol Oncol. 2002, 20: 167-176.View ArticlePubMedGoogle Scholar
- Chen CZ: MicroRNAs as Oncogenes and Tumor Suppressors. N Engl J Med. 2005, 353: 1768-1771.View ArticlePubMedGoogle Scholar
- Calin GA, Croce CM: MicroRNA signatures in human cancers. Nat Rev Cancer. 2006, 6: 857-866.View ArticlePubMedGoogle Scholar
- Esquela-Kerscher A, Slack FJ: Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer. 2006, 6: 259-269.View ArticlePubMedGoogle Scholar
- Lodygin D, Tarasov V, Epanchintsev A, Berking C, Knyazeva T, Korner H, Knyazev P, Diebold J, Hermeking H: Inactivation of miR-34a by aberrant CpG methylation in multiple types of cancer. Cell Cycle. 2008, 7: 2591-2600.View ArticlePubMedGoogle Scholar
- Chim CS, Wong KY, Qi Y, Loong F, Lam WL, Wong LG, Jin DY, Costello JF, Liang R: Epigenetic inactivation of the miR-34a in hematological malignancies. Carcinogenesis. 2010, 31: 745-750.View ArticlePubMedGoogle Scholar
- Pigazzi M, Manara E, Baron E, Basso G: miR-34b Targets Cyclic AMP-Responsive Element Binding Protein in Acute Myeloid Leukemia. Cancer Res. 2009, 69: 2471-2478.View ArticlePubMedGoogle Scholar
- Agirre X, Vilas-Zornoza A, Jimenez-Velasco A, Martin-Subero JI, Cordeu L, Garate L, San Jose-Eneriz E, Abizanda G, Rodriguez-Otero P, Fortes P: Epigenetic Silencing of the Tumor Suppressor MicroRNA Hsa-miR-124a Regulates CDK6 Expression and Confers a Poor Prognosis in Acute Lymphoblastic Leukemia. Cancer Res. 2009, 69: 4443-4453.View ArticlePubMedGoogle Scholar
- Bueno MJ, Perez de Castro I, Gomez de Cedron M, Santos J, Calin GA, Cigudosa JC, Croce CM, Fernandez-Piqueras J, Malumbres M: Genetic and Epigenetic Silencing of MicroRNA-203 Enhances ABL1 and BCR-ABL1 Oncogene Expression. Cancer Cell. 2008, 13: 496-506.View ArticlePubMedGoogle Scholar
- Chim CS, Fung TK, Cheung WC, Liang R, Kwong YL: SOCS1 and SHP1 hypermethylation in multiple myeloma: implications for epigenetic activation of the Jak/STAT pathway. Blood. 2004, 103: 4630-4635.View ArticlePubMedGoogle Scholar
- Chim CS, Liang R, Tam CYY, Kwong YL: Methylation of p15 and p16 Genes in Acute Promyelocytic Leukemia: Potential Diagnostic and Prognostic Significance. J Clin Oncol. 2001, 19: 2033-2040.PubMedGoogle Scholar
- Livak KJ, Schmittgen TD: Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-[Delta][Delta]CT Method. Methods. 2001, 25: 402-408.View ArticlePubMedGoogle Scholar
- Bruchova H, Yoon D, Agarwal AM, Mendell J, Prchal JT: Regulated expression of microRNAs in normal and polycythemia vera erythropoiesis. Experimental Hematology. 2007, 35: 1657-1667.PubMed CentralView ArticlePubMedGoogle Scholar
- Garzon R, Pichiorri F, Palumbo T, Iuliano R, Cimmino A, Aqeilan R, Volinia S, Bhatt D, Alder H, Marcucci G: MicroRNA fingerprints during human megakaryocytopoiesis. Proceedings of the National Academy of Sciences of the United States of America. 2006, 103: 5078-5083.PubMed CentralView ArticlePubMedGoogle Scholar
- Chim CS, Tam CYY, Liang R, Kwong YL: Methylation of p15 and p16 genes in adult acute leukemia. Cancer. 2001, 91: 2222-2229.View ArticlePubMedGoogle Scholar
- Chim CS, Wong ASY, Kwong YL: Epigenetic inactivation of the CIP/KIP cell-cycle control pathway in acute leukemias. American Journal of Hematology. 2005, 80: 282-287.View ArticlePubMedGoogle Scholar
- Chim CS, Wong SY, Pang A, Chu P, Lau JS, Wong KF, Kwong YL: Aberrant promoter methylation of the retinoic acid receptor alpha gene in acute promyelocytic leukemia. Leukemia. 2005, 19: 2241-2246.View ArticlePubMedGoogle Scholar
- Chim CS, Wong ASY, Kwong YL: Epigenetic dysregulation of the Jak/STAT pathway by frequent aberrant methylation of SHP1 but not SOCS1 in acute leukaemias. Annals of Hematology. 2004, 83: 527-532.View ArticlePubMedGoogle Scholar
- Chim CS, Wong SY, Kwong YL: Aberrant gene promoter methylation in acute promyelocytic leukaemia: profile and prognostic significance. Br J Haematol. 2003, 122: 571-578.View ArticlePubMedGoogle Scholar
- Capello D, Deambrogi C, Rossi D, Lischetti T, Piranda D, Cerri M, Spina V, Rasi S, Gaidano G, Lunghi M: Epigenetic inactivation of suppressors of cytokine signalling in Philadelphia-negative chronic myeloproliferative disorders. British Journal of Haematology. 2008, 141: 504-511.View ArticlePubMedGoogle Scholar
- Quentmeier H, Geffers R, Jost E, MacLeod RAF, Nagel S, Rohrs S, Romani J, Scherr M, Zaborski M, Drexler HG: SOCS2: inhibitor of JAK2V617F-mediated signal transduction. Leukemia. 2008, 22: 2169-2175.View ArticlePubMedGoogle Scholar
- Fourouclas N, Li J, Gilby DC, Campbell PJ, Beer PA, Boyd EM, Goodeve AC, Bareford D, Harrison CN, Reilly JT: Methylation of the suppressor of cytokine signaling 3 gene (SOCS3) in myeloproliferative disorders. Haematologica. 2008, 93: 1635-1644.View ArticlePubMedGoogle Scholar
- Chim CS, Fung TK, Liang R: Methylation of cyclin-dependent kinase inhibitors, XAF1, JUNB, CDH13 and soluble Wnt inhibitors in essential thrombocythaemia. Journal of Clinical Pathology. 2010, 63: 518-521.View ArticlePubMedGoogle Scholar
- Wong KY, So CC, Loong F, Chung LP, Lam WWL, Liang R, Li GKH, Jin D-Y, Chim CS: Epigenetic Inactivation of the miR-124-1 in Haematological Malignancies. PLoS One. 2011, 6: e19027-PubMed CentralView ArticlePubMedGoogle Scholar
- Wong KY, Yu L, Chim CS: DNA methylation of tumor suppressor miRNA genes: a lesson from the miR-34 family. Epigenomics. 2011, 3: 83-92.View ArticlePubMedGoogle Scholar
- Wong KY, Liang R, So CC, Jin DY, Costello JF, Chim CS: Epigenetic silencing of MIR203 in multiple myeloma. British Journal of Haematology. 2011, 154: 569-578.View ArticlePubMedGoogle Scholar
- Drexler HG: Guide to Leukemia-Lymphoma Cell Lines. 2010, Braunschweig, 2Google Scholar
- Wong KY, Yim RLH, So CC, Jin D-Y, Liang R, Chim CS: Epigenetic inactivation of the MIR34B/C in multiple myeloma. Blood. 2011, 118: 5901-5904.View ArticlePubMedGoogle Scholar
- Chim CS, Chan WWL, Pang A, Kwong YL: Preferential methylation of Wnt inhibitory factor-1 in acute promyelocytic leukemia: an independent poor prognostic factor. Leukemia. 2006, 20: 907-909.View ArticlePubMedGoogle Scholar
- Chim CS, Kwong YL: Adverse prognostic impact of CDKN2B hyper-methylation in acute promyelocytic leukemia. Leukemia & Lymphoma. 2006, 47: 815-825.View ArticleGoogle Scholar
- Lujambio A, Calin GA, Villanueva A, Ropero S, Sanchez-Cespedes M, Blanco D, Montuenga LM, Rossi S, Nicoloso MS, Faller WJ: A microRNA DNA methylation signature for human cancer metastasis. PNAS. 2008, 0803055105Google Scholar
- Toyota M, Suzuki H, Sasaki Y, Maruyama R, Imai K, Shinomura Y, Tokino T: Epigenetic Silencing of MicroRNA-34b/c and B-Cell Translocation Gene 4 Is Associated with CpG Island Methylation in Colorectal Cancer. Cancer Res. 2008, 68: 4123-4132.View ArticlePubMedGoogle Scholar
- Lujambio A, Ropero S, Ballestar E, Fraga MF, Cerrato C, Setien F, Casado S, Suarez-Gauthier A, Sanchez-Cespedes M, Gitt A: Genetic Unmasking of an Epigenetically Silenced microRNA in Human Cancer Cells. Cancer Res. 2007, 67: 1424-1429.View ArticlePubMedGoogle Scholar
- Chim CS, Wong KY, Leung CY, Chung LP, Hui PK, Chan SY, Yu L: Epigenetic inactivation of the hsa-miR-203 in haematological malignancies. Journal of Cellular and Molecular Medicine. 2011, 15: 2760-2767.PubMed CentralView ArticlePubMedGoogle Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.