Isolation and culture of MSCs
All MSCs were isolated from Sprague–Dawley rats (100–120 g, n = 5) in this experiment. BM-MSCs were collected from the bone marrow by flushing the femur and tibia with medium, and single-cell suspensions were prepared by repetitively pipetting BM-MSCs through 18-gauge needles as described [20]. After centrifugation, cell pellets were suspended in the growth medium. AD-MSCs were isolated from the inguinal adipose tissue of the rats as previously described [24]. The tissue was minced and digested in phosphate-buffered saline (PBS) containing 0.1% type I collagenase (Sigma-Aldrich, St. Louis, Mo, USA) for 60 min at 37°C with vigorous shaking. After centrifugation, the top lipid layers were removed, and the cells were suspended in the growth medium. SM-MSCs were isolated from the synovium tissue, which comes from the inner side of the medial joint capsule using a pituitary rongeur under arthroscopic observation. The synovium tissue was cut into small pieces and was then digested with 0.1% type I collagenase (Sigma) for 60 min at 37°C with vigorous shaking. Cells were then expanded in monolayers in the growth medium according to the described methods [25]. Dulbecco’s modified eagle medium (DMEM, Invitrogen, Carlsbad, CA), supplemented with 10% fetal bovine serum (FBS, Invitrogen), 100 U/mL penicillin, and 100 mg/mL streptomycin (1% P/S, Invitrogen), was used as growth medium. The medium was replaced every 2–3 days. The cells used in subsequent experiments were at passage 3 and were CD90+, CD105+, CD73+/CD45− cells.
Ad-BMP-12 infection
The adenoviral vector Ad-BMP-12 was constructed as we previously reported [26]. A recombinant adenoviral vector expressing green fluorescent protein (GFP) alone was used as a control vector (Ad-GFP). The three types of passage 3 MSCs were cultured in the growth medium to approximately 90% confluence, and Ad-BMP-12 was added according to the multiplicity of infection (MOI). The MSCs infected with Ad-GFP were used as control.
Proliferation assay
The three types of MSCs were seeded in 96-well plates at a density of 5 × 103 cells/well and cultured in the aforementioned growth medium at 37°C under 5% CO2 atmosphere for 1, 2, 3, 4, 5, and 6 days. Cell proliferation activity was measured using Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan), in which 10 μL of the CCK-8 assay solution was added to each well and incubated for 4 h at 37°C. The absorbance was measured using a microplate reader (Bio-Rad, Munich, Germany) at a wavelength of 450 nm.
Chondrogenic, osteogenic and adipogenic differentiation
A pellet culture system was used for chondrogenic differentiation. Approximately 2.5 × 105 MSCs were placed in a 15 mL tube and pelleted under centrifugation at 500 g for 10 min. The pellet was cultured in 500 μL of serum-free chondrogenic induction medium (RASMX-90041, Cyagen). The medium was replaced every 3 days for up to 21 days. For osteogenic differentiation, 3 × 103/cm2 cells were cultured in the osteogenic induction medium (RASMX-90021, Cyagen) for 2–3 weeks according to the manufacturer’s instructions. For adipogenic differentiation, 2 × 104/cm2 cells were cultured in the adipogenic induction medium and the maintenance medium (RASMD-90021, Cyagen), following manufacturer’s instruction. Cells in the control group were maintained only in the maintenance medium according to the same schedule.
Flow cytometric analysis
For surface marker analysis, 1 × 106 of each of the three types of MSCs were washed, incubated with fluorescein isothiocyanate (FITC)-conjugated CD105, CD73, CD45, and CD90 antibodies (Abcam, Cambridge, UK) in 1% FBS/PBS for 1 h. After three washes with 1% FBS/PBS, the cells were resuspended in 500 μL of PBS. For negative controls, FITC-conjugated nonspecific IgG fractions (Abcam) were substituted for the primary antibodies. All the above procedures were performed in the dark at 4°C. The expression profiles of CD105, CD73, CD45, and CD90 on the three types of MSCs were examined using a flow cytometer (B&D, San Jose, CA, USA) and analyzed with Cell-Quest 3.1 software (B&D).
For the assessment of Ad-BMP-12 infection efficiency, the three types of MSCs were first initially subjected to Ad-BMP-12 infection for 1 and 3 days at different MOIs. The infection efficiency was then evaluated using flow cytometer (B&D) and analyzed with Cell-Quest 3.1 software (B&D). The MSCs without Ad-BMP-12 infection were used as control.
Quantitative RT-PCR
Total RNA was extracted from Ad-BMP-12 infected MSCs using TRIzol reagent (Invitrogen). Isolated RNA was reverse-transcribed with a commercial kit (Promega, Madison, WI, USA), and real-time RT-PCR analysis was performed using the Step-One plus System (Applied Biosystems, Foster City, CA, USA) with SYBR Green Select Master Mix (Applied Biosystems). The conditions of real-time RT-PCR were as follows: 50°C for 2 min, 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. A dissociation stage was added at the end of the amplification procedure. There was no nonspecific amplification determined by the dissolved curve. The PCR primers are as follows: peroxisome proliferator-activated receptor γ (PPARγ): forward: 5′ TGGAGCCTAAGTTTGAGTTTGC 3′, reverse: 5′-TGACAATCTGCCTGAGGTCTG-3′; osteocalcin (OCN): forward: 5′-GCACCACCGTTTAGGGCAT-3′, reverse: 5′-AGAGAGAGGGAACAGGGAG-3′; collagen type II (Col II): forward: 5′-CACCGCTAACGTCCAGATGAC-3′, reverse: 5′-GGAAGGCGTGAGGTCTTCTGT-3′; tenomodulin (Tnmd): forward: 5′-GGGATTGACCAGAATGAGCAA-3′, reverse: 5′-GGTGCGGCGGGTCTTC-3′; tenascin C (Tnc): forward: 5′-CAGAAGCTGAACCGGAAGTTG-3′, reverse: 5′-GGCTGTTGTTGCTAGGCACT-3′; scleraxis (SCX): forward: 5′-TGGCCTCCAGCTACATTTCT-3′, reverse: 5′-TGTCACGGTCTTTGCTCAAC-3′; collagen type I (Col I): forward: 5′-TTTCCACATGCTTTATTCCAGC-3′, reverse: 5′-TCCTGGGCCTATCTGATGATCT-3′; GAPDH: forward: 5′-GCAAGTTCAACGGCACAG-3′, reverse: 5′-GCCAGTAGACTCCACGACA-3′. The expression of the above genes relative to GAPDH were determined using the 2−ΔΔCT method [27].
Enzyme-linked immunosorbent assay
The concentration of collagen type I (Col I) secreted into the culture supernatants by MSCs after Ad-BMP-12 infection was measured using a rat Col I enzyme-linked immunosorbent assay (ELISA) kit (Chondrex, Redmond, WA, USA) according to the manufacturer’s instructions. The absorbance was measured using a microplate reader (Bio-Rad) at a wavelength of 450 nm, and the results were compared with a standard curve constructed from a standard Col I solution. We confirmed that these kits did not cross-react with the medium itself, regardless of the presence or absence of FBS.
Protein isolation and Western blotting
Protein was extracted using lysis buffer (50 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% NP- 40, and 0.1% sodium dodecyl sulfate), and the concentration was measured using the BCA protein assay kit (Pierce, Rockford, IL, USA) using bovine serum albumin as the standard. Proteins were run on SDS-PAGE gels (12%) and electro-transferred to nitro-cellulose membrane at 4°C for 2 h. The blots were probed with anti-SCX (Abcam), anti-Tnmd (Santa Cruz, Santa Cruz, CA, USA) and anti-Tnc (Santa Cruz) at 1:1,000 dilutions overnight at 4°C, followed by incubation with horseradish peroxidase-conjugated secondary antibody (Santa Cruz, 1:1,000 dilutions) at room temperature for 1 h. Proteins were detected by chemiluminescence according to the manufacturer’s recommendations (ECL, Millipore, Bedford, MA, USA). Beta-tublin (Santa Cruz) was used as an internal control.
In vivo implantation and histological analysis
All animal experimental protocols were approved by the Animal Care and Use Committee of Peking University and conformed to the National Institutes of Health guidelines (LA 2010–066). MSCs infected with Ad-BMP-12 or Ad-GFP (4 × 106) were injected subcutaneously into the right axillary region of nude mice (n = 8). MSCs infected with Ad-GFP were used as control. After 3 and 6 weeks, the mice were sacrificed with ether anesthesia, samples were measured with weight and area, and then were fixed in 4% paraformaldehyde (pH 7.4) for 48 h at 4°C. For standard histological evaluation, the sections were stained with hematoxylin and eosin (H&E). For immunohistochemical staining, the sections were incubated overnight at 4°C with anti-Col I, followed by a 30 min incubation with a secondary antibody conjugated with horseradish peroxidase (1:1,000, Santa Cruz) in 0.1% PBS. Col I was quantified using Image-Pro Plus 6.0 software (Media Cybernetics, Silver Spring, MD, USA).
Statistical analysis
For statistical analysis, the statistical significance of the differences between groups was calculated using analysis of variance (ANOVA). The results from the same group were evaluated using Student’s t test. P values <0.05 were considered statistically significant. All data are presented as mean ± SD.
