Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Oligonucleotide sequences of target genes

From: Detection of activated KRAS from cancer patient peripheral blood using a weighted enzymatic chip array

Gene Oligonucleotide sequences (5′ → 3′)
ATP2A2 ACCCGGACTTTGAAGGCTTGGATTGTGCAATCTTTGAATCCCCATACCCG
ATP6V0B CATCGGCCATCGGAACTACCATGCAGGCTACTCCATGTTTGGGGCT
BCL2 ACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACA
CALM2 GAAGCATTCCGTGTGTTTGATAAGGATGGCAATGGCTATATTAGTGCTGCAGAACTTCG
CEBPB CCGCCTGCCTTTAAATCCATGGAAGTGGCCAACTTCTACTACGAGGCGGA
CLSTN1 TCTCTCCTCTCTCCTCCCCAGAGCACCCCCTGCCATCAGGGGGGTTGAAA
COL4A1 GCAAATGTGACTGCCATGGAGTGAAGGGACAAAAGGGTGAAAGAGGCCTC
CXCL11 GTTCAAGGCTTCCCCATGTTCAAAAGAGGACGCTGTCTTTGCATAGGCCC
CXCR4 CCCCATCCTCTATGCTTTCCTTGGAGCCAAATTTAAAACCTCTGCCCAGCAC
CYR61 CAGCAGCCTGAAAAAGGGCAAGAAATGCAGCAAGACCAAGAAATCCCCCG
DVL3 CGTCACCTTGGCGGACTTTAAGGGCGTTTTTGCAGCGACCCAGCTATAAGT
E2F4 TGAGATCACAGTGAGTGGCGGCCCTGGGACTGATAGCAAGGACAGT
ETS1 TGGAGCAGCCAGTCATCTTTCAACAGCCTGCAGCGTGTTCCCTCCTATGA
H2AFZ CGTGGAGATGAAGAATTGGATTCTCTCATCAAGGCTACAATTGCTGGTGGTGGTGTC
L1CAM CCTTCCTGGTGGTGTCCAACACGTCCACCTTCGTGCCCTATGAGATCAAA
LRP1 ATGCCTGTGAAAACGACCAGTATGGGAAGCCGGGTGGCTGCTCTGACAT
RAP1B GGAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTAGCAAGACAATGGAACAACTGTG
RPL30 GCTCCAACTCGTTATGAAAAGTGGGAAGTACGTCCTGGGGTACAAGCAGAC
SLC25A5 TCTGATGGGATTAAGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGG
SPP1 GTGGACAGCCAGGACTCCATTGACTCGAACGACTCTGATGATGTAGATGAC
TAF12 CAGCACCCCTCCACAAGGCTCCATGGCCAATAGTACTGCAGTGGTAAAGA
TBX19 TCATCTGCTCAATGTGGTGGAGAGTGAGCTTCAGGCAGGGAGGGAAAAAG
β-actin TGCATTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGGAGA