Skip to main content

Table 1 Primers used in real-time RT-PCR analysis

From: Exosomes derived from myeloid-derived suppressor cells facilitate castration-resistant prostate cancer progression via S100A9/circMID1/miR-506-3p/MID1

Primer Sequence (5′ to 3′)
has_circ_0009154-F ATTAGTTCCGTCACAGGGGC
has_circ_0009154-R AGGTCCTGCTATTTCTCCTCT
has_circ_0085361-F GGATGAATCCCAGTCCCTGT
has_circ_0085361-R GCCTTCACTTGCAACGTTTC
has_circ_0007718-F TGGCTAAACTCATCCAAACCTG
has_circ_0007718-R GCAAAACCCAAGGAAGCTGA
has_circ_0001944-F GGGAAGACTTGGTTGTGCAG
has_circ_0001944-R GTGTTTGCAAGCCAGGTACA
has_circ_0026782-F TCCCCTGATAGCCACTACCT
has_circ_0026782-R CTTGCCTCATATCGGTGTGC
has_circ_0018064-F GGCGGTCCCTCATCAAGAA
has_circ_0018064-R CTCAGCTTGGCTCGTTCATC
has_circ_0086414-F ATGCTGCATTCCCCTCTCG
has_circ_0086414-R TTCTCGAGACATGATGGCCC
has_circ_0004119-F TGAGGATCCAGAACTAACGCA
has_circ_0004119-R TTCCAACTGCTCCATTCCCT
MID1-F GCTGGGGGAGAAAAGGTTGA
MID1-R AAAAGCAACCCGGCGAAATC
GAPDH-F TCGGAGTCAACGGATTTGGT
GAPDH-R TTCCCGTTCTCAGCCTTGAC
U6-F CTCGCTTCGGCAGCACA
U6-R AACGCTTCACGAATTTGCGT
miR-506-3p-F ACACTCATAAGGCACCCTTC
miR-506-3p-R TCTACTCAGAAGGGGAGTAC