Skip to main content

Table 1 Primer sequences

From: MicroRNA-449a delays lung cancer development through inhibiting KDM3A/HIF-1α axis

Primer sequences Forward (5’ → 3’) Reverse (5’ → 3’)
miR-449a CTCGCTGGCAGTGTATTGTTAG TATCGTTGTACTCCAGACCAAGAC
KDM3A AACTATTGAGCCACACAGACAGG ACACATACTCCAAACCCACACC
HIF-1α GGTTCCAGCAGACCCAGTTA AGGCTCCTTGGATGAGCTTT
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
β-actin CATCACCATCTTCCAGGAGCG TGACCTTGCCCACAGCCTTG
  1. miR-449a microRNA-449a, KDM3A Lysine demethylase 3A, HIF-1α Hypoxia-induced factor-1α