Skip to main content

Table 3 Primers used in this study

From: Identification and validation of smoking-related genes in lung adenocarcinoma using an in vitro carcinogenesis model and bioinformatics analysis

Primer name Primer sequence 5′ to 3′
F_GYPC GCCGGATGGCAGAATGGAG
R_GYPC GGAGGGAGACTAGGACGATGG
F_NME1 AAGGAGATCGGCTTGTGGTTT
R_NME1 CTGAGCACAGCTCGTGTAATC
F_SLIT2 AGCCGAGGTTCAAAAACGAGA
R_SLIT2 GGCAGTGCAAAACACTACAAGA
F_GAPDH CTGGGCTACACTGAGCACC
R_GAPDH AAGTGGTCGTTGAGGGCAATG