Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sequences of the primers used for RT-qPCR

From: CCNB1 affects cavernous sinus invasion in pituitary adenomas through the epithelial–mesenchymal transition

Gene Forward primer Reverse primer
CCNB1 (human) TGTTGGTTTCTGCTGGGTGT TGCCATGTTGATCTTCGCCT
E-Cadherin (human) GCTGGACCGAGAGAGTTTCC CAAAATCCAAGCCCGTGGTG
N-Cadherin (human) GGGAAATGGAAACTTGATGGCA CAGTTGCTAAACTTCACTGAAAGGA
GAPDH (human) AATGGGCAGCCGTTAGGAAA GCCCAATACGACCAAATCAGAG
CCNB1 (rat) ATCGGTTCATGCAGGACAGT TGGAGGGTACATCTCCTCGT
E-Cadherin (rat) TTGAGAATGAGGTCGGTGCC ATCCAAGCCCTTGGCTGTTT
N-Cadherin (rat) CACCCGGCTTAAGGGTGATT CGATCCTGTCTACGTCGGTG
GAPDH (rat) AGTGCCAGCCTCGTCTCATA GACTGTGCCGTTGAACTTGC