Skip to main content

Advertisement

Table 1 Primer sequences for the real time PCR

From: Role of MAML1 in targeted therapy against the esophageal cancer stem cells

  Sequence Thermal profile Size (bp)
HES1 F: CCCAACGCAGTGTCACCTTC R: TACAAAGGCGCAATCCAATATG 95 °C(10 min)[95 °C(30 s)/58 °C(30 s)/72 °C(30 s)]40 304
GAPDH F: GGAAGGTGAAGGTCGGAGTCA R: GTCATTGATGGCAACAATATCCACT 95 °C(10 min)[95 °C(30 s)/58 °C(30 s)/72 °C(30 s)]40 108
HEY1 F: ACGGCAGGAGGGAAAGGTTAC R: CTGGGAAGCGTAGTTGTTGAGATG 95 °C(10 min)[95 °C(30 s)/58 °C(30 s)/72 °C(30 s)]40 294
HEY2 F: AGAAAAGGAGAGGGATTATAGAGAAAAGG R: AGCGTGTGCGTCAAAGTAGC 95 °C(10 min)[95 °C(30 s)/58 °C(30 s)/72 °C(30 s)]40 300
Nanog F: GCAATGGTGTGACGCAGAAGGC R: GCTCCAGGTTGAATTGTTCCAGGTC 95 °C(10 min)[95 °C(30 s)/65 °C(30 s)/72 °C(30 s)]40 137
Bmi1 F: CGTGTATTGTTCGTTACCTGGAGAC R: CATTGGCAGCATCAGCAGAAGG 95 °C(10 min)[95 °C(30 s)/62 °C(30 s)/72 °C(30 s)]40 204
CD44s F: TCCAACACCTCCCAGTATGACA R: GGCAGGTCTGTGACTGATGTACA 95 °C(10 min)[95 °C(15 s)/60 °C(60 s)]40 83
CD44v3 F: GCACTTCAGGAGGTTACATC R: CTGAGGTGTCTGTCTCTTTC 95 °C(10 min)[95 °C(15 s)/60 °C(60 s)]40 181
CD44v6 F: AGGAACAGTGGTTTGGCAAC R: CGAATGGGAGTCTTCTCTGG 95 °C(10 min)[95 °C(15 s)/60 °C(30 s)]40 68
MAML1 F: TCTCGCGGAACAGGAGA R: GCAGCAGAGGACCCTGTG 95 °C(10 min)[95 °C(30 s)/58 °C(30 s)/72 °C(30 s)]40 123