Skip to main content

Table 1 Primers for qRT-PCR

From: Atheroprotective effects of methotrexate via the inhibition of YAP/TAZ under disturbed flow

GeneForwardReverse
AMPK-αTGATGTTGTAGTGACACCATTTACGAAGATGAGGGAAAGAATTAAGGG
CTGFACCGACTGGAAGACACGTTTGCCAGGTCAGCTTCGCAAGG
CYR-61TGAAGCGGCTCCCTGTTTTCGGGTTTCTTTCACAAGGCG
VCAM1CAGTAAGGCAGGCTGTAAAAGATGGAGCTGGTAGACCCTCG
ICAM1TTGGGCATAGAGACCCCGTTGCACATTGCTCAGTTCATACACC
IL-6CTCAATATTAGAGTCTCAACCCCCAGAGAAGGCAACTGGACCGAA
IL-8CCACCGGAGCACTCCATAAGGATGGTTCCTTCCGGTGGTT
YAPGCTACAGTGTCCCTCGAACCCCGGTGCATGTGTCTCCTTA
TAZATCCCCAACAGACCCGTTTCGAACGCAGGCTTGCAGAAAA
GAPDHACGGATTTGGTCGTATTGGGCTTGACGGTGCCATGGAATTTG