Skip to main content

Table 1 Primers for RHD gene amplification and sequencing

From: Molecular and computational analysis of 45 samples with a serologic weak D phenotype detected among 132,479 blood donors in northeast China

Primer denotation Sequence (5′ to 3′) Specificity GenBank accession number Location Product size (bp)
E1-s(= E1-seq) TCCATAGAGAGGCCAGCACAA D AJ252314 5′UTR − 152 to − 132 340
E1-a GCTATTTGCTCCTGTGACCACTT D Z97363 +40 to +18  
E2-s TGACGAGTGAAACTCTATCTCGAT D U66341 -1060 to -1037 1602
E2-a GGCATGTCTATTTCTCTCTGTCTAAT D/CE U66341, AB035189 +355 to +330  
E2-seq CCTGGATTCCTTGTGATACACG D/CE U66341, U66340 +227 to +206  
E3-s GTCGTCCTGGCTCTCCCTCTCT D AB035190 − 29 to − 8 219
E3-a CTTTTCTCCCAGGTCCCTCCT D/CE AB035192, AB035191 +39 to +19  
E3-seq GGTCCCTCCTCCCAGCAC D/CE AB035192, AB035191 +28 to +11  
E4-s GCCGACACTCACTGCTCTTAC D/CE U77079, U77078 − 36 to − 16 378
E4-a TGAACCTGCTCTGTGAAGTGC D Y10605 +194 to +174  
E4-seq GGGAGATTTTTTCAGCCAG D/CE Y10605, Y10604 +82 to +64  
E5-s TACCTTTGAATTAAGCACTTCACAG D Y10605 − 267 to − 243 1458
E5-a TTATTGGCTACTTGGTGCC D/CE Z97334, AB035197 +1024 to +1006  
E5-seq AGACCTTTGGAGCAGGAGTG D/CE Y10605, Y10604 − 53 to − 34  
E6-s(= E6-seq) CAGGGTTGCCTTGTTCCCA D/CE Z97334, Z97333 − 95 to − 97 274
E6-a CTTCAGCCAAAGCAGAGGAGG D Z97334 +41 to +21  
E7-s TGCCCATCCCCCTTTGGTGGCC D Z97334 − 106 to − 85 411
E7-a CCAAGGTAGGGGCTGGACAG D AB035194 +171 to +152  
E7-seq GTCTCACCTGCCAATCTGCT D/CE Z97334, Z97333 − 41 to − 22  
E8-s GGTCAGGAGTTCGAGATCAC D AB035194 − 593 to − 574 770
E8-a(= E8-seq) GATGGGGCACATAGACATCC D/CE AB035196 +97 to +78  
E9-s(= E9-seq) GGTCCAGGAATGACAGGGCT D AB035196 − 162 to − 143 530
E9-a CGCTGAGGACTGCAGATAGG D AB035185 +294 to +275  
E10-s CAAGAGATCAAGCCAAAATCAGT D/CE AB035185, AB035184 − 67 to − 45 381
E10-a AGCTTACTGGATGACCACCA D X63097 +290 to +271  
E10-seq CAGTCTGTTGTTTACCAGATGTTGTTAT D X63097 3′UTR +261 to +234  
  1. Primers cited from [24]
  2. s sense primer, a antisense primer, seq sequencing primer