Genetic instability and increased mutational load: which diagnostic tool best direct patients with cancer to immunotherapy?

Table 1 Sequence repeats at the five marker loci commonly used for PCR-based microsatellite analysis

Marker	Chromosome location	Gene location	Microsatellite repeat unit	Oligonucleotide primers		Amplicon lenght (bp)
BAT25	4p12	cKIT	Mononucleotide	Forward	TCGCCTCCAAGAATGTAAGT	118–123
BAT25	4p12	cKIT	Mononucleotide	Reverse	TCTGCATTTTAACTATGGCTC	118–123
BAT26	2p16.3–p21	hMSH2	Mononucleotide	Forward	TGACTACTTTTGACTTCAGCC	109–114
BAT26	2p16.3–p21	hMSH2	Mononucleotide	Reverse	AACCATTCAACATTTTTAACCC	109–114
D2S123	2p16	hMSH2	Dinucleotide	Forward	AAACAGGATGCCTGCCTTTA	197–227
D2S123	2p16	hMSH2	Dinucleotide	Reverse	GGACTTTCCACCTARGGGAC	197–227
D5S346	5q21/22	APC	Dinucleotide	Forward	ACTCACTCTAGTGATAAATCGGG	96–122
D5S346	5q21/22	APC	Dinucleotide	Reverse	AGCAGATAAGACAGTATTACTAGTT	96–122
D17S250	17q11.2–q12	BRCA1	Dinucleotide	Forward	GGAAGAATCAAATAGACAAT	151–169
D17S250	17q11.2–q12	BRCA1	Dinucleotide	Reverse	GCTGGCCATATATATATTTAAACC	151–169

ISSN: 1479-5876