Skip to main content

Table 1 Sequences of primers used for quantitative RT-PCR

From: A novel non-Hodgkin lymphoma murine model closer to the standard clinical scenario

Gene Forward primer (5′–3′) Reverse primer (5′–3′) Product length (bp)
B2m CCTGCAGAGTTAAGCATGCCAG TGCTTGATCACATGTCTCGATCC 72
Ccl2 CCCTCAACGGAAGAACCAAA CACATCAGGTACGATCCAGGC 72
Ccl3 AACATCATGAAGGTCTCCAC CCAAGACTCTCAGGCATTCA 294
Ccl4 GCCCTCTCTCTCCTCTTGCT GTCTGCCTCTTTTGGTCAGG 196
Ccl5 GGTACCATGAAGATCTCTGCA AAACCCTCTATCCTAGCTCAT 294
Ccl20 TTTTGGGATGGAATTGGACAC TGCAGGTGAAGCCTTCAACC 69
Cxcr4 TTCTCATCCTGGCCTTCATC CTTTTCAGCCAGCAGTTTCC 92
Cxcr7 GCCGTACCATTTTGTGGTTC TGCAACGCTGTAAAGAGCAC 96
Cxcl1 CTTGGTTCAGAAAATTGTCCAAAA ACGGTGCCATCAGAGCAGTCT 84
Cxcl9 TGGAGCAGTGTGGAGTTCGA CCTCGGCTGGTGCTGATG 73
Cxcl10 GCCGTCATTTTCTGCCTCAT GCTTCCCTATGGCCCTCATT 127
Cxcl11 CAAAATGGCAGAGATCGAGAAA TGAGCCTTCATAGTAACAATCACTTCA 87
Cxcl12 GAAGTGGAGCCATAGTAATGCC TCCAAGTGGAAAAATACACCG 133
Cxcl13 CAACTGTTGTCGGTCTAAACATCAT GGTCCAGATCACAACTTCAGTTTTG 89
Gal-1 (Galectina-1) TGAACCTGGGAAAAGACAGC TCAGCCTGGTCAAAGGTGAT 190
Il2 CCTGAGCAGGATGGAGAATTACA CTTTCAATTCTGTGGCCTGCTTGGG 92
Il4 ACAGGAGAAGGGACGCCAT GAAGCCCTACAGACGAGCTCA 95
Il6 GTTCTCTGGGAAATCGTGGAAA AAGTGCATCATCGTTGTTCATACA 78
Il10 CATTTGAATTCCCTGGGTGAGA TGCTCCACTGCCTTGCTCTT 101
Il12 ATCACACGGGACCAAACCA CAGGCAACTCTCGTTCTTGTGTAGT 74
Il17a CTCCAGAAGGCCCTCAGACTAC GGGTCTTCATTGCGGTGG 69
Ifng TCAGCAACAGCAAGGCGAAA CCGCTTCCTGAGGCTGGAT 143
Tgfb GCTGAACCAAGGAGACGGAAT GAGTTTGTTATCTTTGCTGTCACAAGA 76
Foxp3 CCCAGGAAAGACAGCAACCTT TTCTCACAACCAGGCCACTTG 89
Tnfa CATCTTCTCAAAATTCGAGTGACAA CCTCCACTTGGTGGTTTGCT 63