Skip to main content

Table 3 List of primers used for quantitative qRT-PCR analysis

From: Immune response and innervation signatures in aseptic hip implant loosening

Gene GenBank number Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
B2M [NM_004048] CCAGCGTACTCCAAAGATTCAG AGTCAACTTCAATGTCGGATGG
β-actin [NM_001101] TACCTCATGAAGATCCTCA TTCGTGGATGCCACAGGAC
IL-1β [NM_000576] CTTCAGCCAATCTTCATT CACTGTAATAAGCCATCAT
IL-6 [NM_000600] CAATCTGGATTCAATGAGGAGACT CTGTTCTGGAGGTACTCTAGGTAT
IL-10 [NM_000572] GGAGAACCTGAAGACCCTCA TATAGAGTCGCCACCCTGAT
IL-12a [NM_000882] TACCAGGTGGAGTTCAAG GTTCTTCAAGGGAGGATTT
iNOS [NM_000625] AATTGAATGAGGAGCAGGTC TCCTTCTTCGCCTCGTAA
TNF-α [NM_000594] TCTCTCTAATCAGCCCTCTG TGCTACAACATGGGCTACAG
RANKL [NM_003701] GGATGGCTCATGGTTAGA CAAGAGGACAGACTCACTT
TGF-β1 [NM_000660] CCTGGACACCAACTATTG CTTGCGGAAGTCAATGTA