Skip to main content

Table 1 The primers sequences used for RT-PCR

From: Advantages of pure platelet-rich plasma compared with leukocyte- and platelet-rich plasma in promoting repair of bone defects

  Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
Runx2 CCAACCCACGAATGCACTATC TAGTGAGTGGTGGCGGACATAC
OC CCCCCTCTAGCCTAGGACC ACCAGGTAATGCCAGTTTGC
COX-2 CTTCACGCATCAGTTTTTCAAG TCACCGTAAATATGATTTAAGTCCAC
iNOS GCTGCCAAGCTGAAATTGA GATAGCGCTTCTGGCTCTTG
β-Actin TTCAACACCCCAGCCATGT GTGGTACGACCAGAGGCATACA
\