Skip to main content

Table 1 Taqman primer and probe sequences for real-time PCR

From: Berberine derivatives reduce atherosclerotic plaque size and vulnerability in apoE−/− mice

Gene Forward primer Reverse primer Probe
CD68 CCGAATCCTATACCCAATTC CTTGGTTTTGTTGGGATTCA TGGAAGAAAGGTAAAGCT
α-SMA CCTCCAGAACGCAAGTACTC CTTCGTCGTATTCCTGTTTG CTGGATCGGTGGCTC
EMMPRIN CAGAAAACCCACCTGGAAGA ATAAACCCCTAAGGAATGGA CAGCCCCTGTTTCT
MMP9 TCAAGGATTGCTCAGAGATT GCAACCACAGTGAGTGAGTT CCCAGACTCCTCTCT
NFkB p65 GGCAGTATTCCTGGCGAGAGA CCAGGGAGATTCGAACTGTT ATGGCTACACAGGACC
ICAM-1 CCTTAGCAGCTGAACAATCG TAAGGAGTTGGAACATTTCC AGGCGGCTCCACC
VCAM-1 GACAAGTCCCCATCGTTGAA ACCTCGCGACGGCATAATTT CTGGAATGGTCCCATGAT
  1. α-SMA, α-smooth muscle actin; EMMPRIN, extracellular matrix metalloproteinases inducer; ICAM-1, intercellular adhesion molecule-1; MMP-9, metalloproteinase-9; NFκB, nuclear factor-κB; VCAM-1, vascular cell adhesion molecule-1.