Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sequences for target gene primers for qRT-PCR

From: miR-200c Inhibits invasion, migration and proliferation of bladder cancer cells through down-regulation of BMI-1 and E2F3

Gene Primer sequence 5’-3’ Tm (°C)
RNU6B F: CTCGCTTCGGCAGCACA 59.42
R: AACGCTTCACGAATTTGCGT 55.75
miR-200c F: TAATACTGCCGGGTAATGATGG 58.21
R: TCGTATCCAGTGCAGGGTC 59.72
GAPDH F: TGCACCACCAACTGCTTAG 60.07
R: AGTAGAGGCAGGGATGATGTTC 59.72
Bmi1 F: TGGATCGGAAAGTAAACAAAGAC 56.60
R: TGCATCACAGTCATTGCTGCT 58.01
E2F3 F: TGCCTGACTCAATAGAGAGCCTAC 61.97
R: TCCCATTGTGGTCTTGGTTGT 58.01
E-cadherin F: GAAAGCGGCTGATACTGACC 59.85
R: CGTACATGTCAGCCGCTTC 59.72
Vimentin F: GGGAGAAATTGCAGGAGGAG 59.85
R: AGGTCAAGACGTGCCAGAGAC 61.92