Skip to main content

Table 2 Primers of DR3, PDCD5, p53 and FasL for real-time PCR

From: Therapeutic effect of daphnetin on the autoimmune arthritis through demethylation of proapoptotic genes in synovial cells

Target gene Locus Sense sequence(5'-3') Antisense sequence(5'-3') Product size(bp)
DR3 NM_001137644.1 gctacgaacctacaacataccg acagtcccaagaaggaacgag 181
PDCD5 NM_001106247.1 acgaaagcagtggagaactacc ttcttttctgtctgttggctga 119
p53 NM_030989.3 gcccatccttaccatcatcac cacaaacacgaacctcaaagc 80
FasL NM_012908.1 ggtgctaatggaggagaagaag aaatggtcagcaacggtaagat 105
DNMT3a NM_001003958.1 gtgcttaccaatacgatgacga atccacacactccacacaaaag 122
DNMT3b NM_001003959.1 ggtaggagatggagatggtgaa atactgttgctgtttcgggttc 138
DNMT1 NM_053354.3 gtgtggtgtctgtgaggtctgt gtttcttcttcttcccttggtg 221
β-actin NM_001009180.2 tgacaggatgcagaaggaga tagagccaccaatccacaca 106