Skip to main content

Table 1 PCR primers used

From: Angiogenic properties of aged adipose derived mesenchymal stem cells after hypoxic conditioning

Gene Sense strand Antisense strand
c-myc AGTGCTGCATGAGGAGACAC GGTTTGCCTCTTCTCCACAG
p53 TCCCCCGCAAAAGAAAA CTGTAGCATGGGCATCCTTT
oct-4 ACATGAAAGCCCTGCAGAAG AGATGGTGGTCTGGCTGAAC
18s CAGTAAGTGCGGGTCATAAGC ATCCGAGGGCCTCACTAAAC
VEGF-a AGAGCAGAAGTCCCATGAAGTGA TCAATCGGACGGCAGTAGCT
PlGF CCAAGGGGAAGAGGAAGAGGAGTA GCAGGGACGAGTCGGCTAATAA
bFGF GCGCCGCCTTCCCACCAG AGCCAGCAGCCGTCCATCTTCCT
HGF TCATTGGTAAAGGAGGCAGCTATA CTGGCATTTGATGCCACTCTTA
TGFb TGCCCCTATATTTGGAGCCTGGAC GCCCGGGTTGTGTTGGTTGTAGAG
uPA GAATGCGCCTGCTGTCC AGGGTCGCTTCTGGTTGTC
uPAR CGTTACCTCGAGTGTGCGTCCTG AGCCTCGGGTGTAGTCCTCATC
MMP2 AGTTCCCGTTCCGCTTCC AGCCTCGGGTGTAGTCCTCATCC
MMP9 GCGGTGTGGGGCGAGGTG CCAGGGGGAAAGGCGTGTGC
ENDS AGTTTGGTCTTGCTGCTGGTG AAGTCCCGGAAGAAGAGTTTTG
TBS1 GCGCGGAGCTGGATGTA AATGTCTTCTGGGGTGGTTC
PAI-1 GCTTCATGCCCCACTTCTTCAA ACCAGGCGTGTCAGCTCGTCTA
L7 CTCCGTCTGCGGCAGATC CAGCATGTTAATTGAAGCCTTGTT
GAPDH GACCCCTTCATTGACCTCAACTAC TGGTGGTGCAGGATGCATTGCTGA