Skip to main content

Table 1 The sequences of primers, product length and annealing temperatures used in RT-PCR reactions

From: Human embryonic stem cells hemangioblast express HLA-antigens

Gene Forward primer Reverse primer Size (bp) Annealing temperature
β-Actin TTTGAATGATGAGCCTTCGTCCCC GGTCTCAAGTCAGTGTACAGGTAAGC 129 59
T TGTCCCAGGTGGCTTACAGATGAA GGTGTGCCAAAGTTGCCAATACAC 144 59
FOXA2 CCATTGCTGTTGTTGCAGGGAAGT CACCGTGTCAAGATTGGGAATGCT 196 59
NeuroD CCCATGGTGGGTTGTCATATATTCATGT CCAGCATCACATCTCAAACAGCAC 196 59
KDR CCTCTACTCCAGTAAACCTGATTGGG TGTTCCCAGCATTTCACACTATGG 219 59
CD34 AAATCCTCTTCCTCTGAGGCTGGA AAGAGGCAGCTGGTGATAAGGGTT 216 59
CD31 ATCATTTCTAGCGCATGGCCTGGT ATTTGTGGAGGGCGAGGTCATAGA 159 59
SCL AAGGGCACAGCATCTGTAGTCA AAGTCTTCAGCAGAGGGTCACGTA 104 59
PTCH CGCTGTCTTCCTTCTGAACC ATCAGCACTCCCAGCAGAGT 282 60
GLI1 CTCTGAGACGCCATGTTCAA ATCCGACAGAGGTGAGATGG 282 60
ε-globin CACTAGCCTGTGGAGCAAGATGAA AATCACCATCACGTTACCCAGGAG 304 59
γ-globin CGCTTCTGGAACGTCTGAGGTTAT CCAGGAGCTTGAAGTTCTCAGGAT 370 59
β-globin TGTCCACTCCTGATGCTGTTATGG AGCTTAGTGATACTTGTGGGCCAG 302 59