Skip to main content

Table 1 The primer sequences used in Real-time quantitative reverse transcription-PCR

From: Sequential combination of decitabine and idarubicin synergistically enhances anti-leukemia effect followed by demethylating Wnt pathway inhibitor promoters and downregulating Wnt pathway nuclear target

Gene name Sequences Length
F(5′—3′) R(3′—5′)  
SKRP-1 ACTGGCCCGAGATGCTTAAGTG GAGATGTTCAATGATGGCCTCAGA 158 bp
DKK3 TGCTGCTAAAGCATCATCAGAAGTG ACCATTTGTCCAGTCTGGTTGTTG 150 bp
HDPR1 TGAGCATCCGGCAAGGTACA CATGGAGACACTGCCCTGAAGA 131 bp
β-catenin GAGTGCTGAAGGTGCTATCTGTCTG TTCTGAACAAGACGTTGACTTGGA 115 bp
C-MYC CCTGGTGCTCCATGAGGAGA TCCAGCAGAAGGTGATCCAGAC 145 bp
Cyclin D1 ATGTTCGTGGCCTCTAAGATGA CAGGTTCCACTTGAGCTTGTTC 138 bp