Skip to main content

Advertisement

Table 1 Primer sequences

From: Mesenchymal stem cells and Interleukin-6 attenuate liver fibrosis in mice

Gene Sequence Product size
Bax (F) TGGAGATGAACTGGACAGCA 182
Bax (R) CAAAGTAGAAGAGGGCAACCAC  
Bcl-xl (F) TTCGGGATGGAGTAAACTGG 150
Bcl-xl (R) AAGGCTCTAGGTGGTCATTCAG  
Albumin (F) GCTGTAGTGGATCCCTGGTG 196
Albumin (R) GCTGTAGCCTTGGGCTTG  
Cytokeratin-8 (F) CTCACTAGCCCTGGCTTCAG 232
Cytokeratin-8 (R) ACAGCTGTCTCCCCGTGA  
Caspase3 (F) TGTCATCTCGCTCTGGTACG 220
Caspase 3 (R) AAATGACCCCTTCATCACCA  
NF-κB (F) GCACCTGTTCCAAAGAGCAC 200
NF-κB (R) GTGGAGTGAGACATGGACACAC  
TNF-α (F) ACGGCATGGATCTCAAAGAC 162
TNF-α (R) GGAGGTTGACTTTCTCCTGGTA  
βactin (F) GCTGTGTTGTCCCTGTATGC 106
βactin (R) GAGCGCGTAACCCTCATAGA