Skip to main content

Table 1 Primer sequences

From: Mesenchymal stem cells and Interleukin-6 attenuate liver fibrosis in mice

Gene

Sequence

Product size

Bax (F)

TGGAGATGAACTGGACAGCA

182

Bax (R)

CAAAGTAGAAGAGGGCAACCAC

 

Bcl-xl (F)

TTCGGGATGGAGTAAACTGG

150

Bcl-xl (R)

AAGGCTCTAGGTGGTCATTCAG

 

Albumin (F)

GCTGTAGTGGATCCCTGGTG

196

Albumin (R)

GCTGTAGCCTTGGGCTTG

 

Cytokeratin-8 (F)

CTCACTAGCCCTGGCTTCAG

232

Cytokeratin-8 (R)

ACAGCTGTCTCCCCGTGA

 

Caspase3 (F)

TGTCATCTCGCTCTGGTACG

220

Caspase 3 (R)

AAATGACCCCTTCATCACCA

 

NF-κB (F)

GCACCTGTTCCAAAGAGCAC

200

NF-κB (R)

GTGGAGTGAGACATGGACACAC

 

TNF-α (F)

ACGGCATGGATCTCAAAGAC

162

TNF-α (R)

GGAGGTTGACTTTCTCCTGGTA

 

βactin (F)

GCTGTGTTGTCCCTGTATGC

106

βactin (R)

GAGCGCGTAACCCTCATAGA