Skip to main content

Advertisement

Table 1 Primers and probes used for quantitative methylation-specific polymerase chain reaction (qMSP)

From: MGMT promoter methylation in gliomas-assessment by pyrosequencing and quantitative methylation-specific PCR

Assay Sequence
MGMT qMSP a  
Forward primer GCGTTTCGACGTTCGTAGGT
Reverse primer CACTCTTCCGAAAACGAAACG
Probe 6FAM-AAACGATACGCACCGCGA-MGB
MGMT_1 qMSP b  
Forward primer CGAATATACTAAAACAACCCGCG
Reverse primer TTTTTTCGGGAGCGAGGC
Probe 6FAM-CGCGATACGCACCGTTTACG-MGB
ALU qMSP c  
Forward primer GGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA
Reverse primer ATTAACTAAACTAATCTTAAACTCCTAACCTCA
Probe 6FAM-CCTACCTTAACCTCCC-MGB
  1. Abbreviations: qMSP, quantitative methylation-specific polymerase chain reaction; MGB, minor groove binder
  2. a) Modified after Rivera et al., Neuro Oncol. (2010)
  3. b) Modified after Hoque et al., J. Natl. Cancer Inst. (2006)
  4. c) Weisenberger et al., Nucleic Acids Res. (2005)