Skip to main content

Table 1 PCR primer sequences, G6PD gene fragments amplified and PCR product sizes

From: Five novel glucose-6-phosphate dehydrogenase deficiency haplotypes correlating with disease severity

Frag-ment Exon(s) Forward primer sequence (5’-3’) Reverse primer sequence (5’-3’) PCR product size
1 1,2 CAATAGGGCCGGCTTGAC TGCAACAATTAGTTGGAAAAGC 1376bp
2 3,4,5 TGTCCCCAGCCACTTCTAAC CTCATAGAGTGGTGGGAGCA 1125bp
3 6,7 AGGGGTTCAAGGGGGTAAC TGCAGGGTGACTGGCTCT 563bp
4 8 ACAGGGCGGGGAGCTAAG GTGCCTCGTCACAGATGG 202bp
5 9,10 CCTGAGGGCTGCACATCT GTGTCTTGCTGATGCCACTG 741bp
6 11,12,13 TGGCATCAGCAAGACACTCT GACAAGGAAGTGGGTCCTCA 1151bp