Skip to main content

Table 1 Sequences of primers used for qMSP and qRT-PCR assays

From: Whole genome methylation profiles as independent markers of survival in stage IIIC melanoma patients

qMSP
GENE Primer sequence1 Amplicon size (bp)2
SLC6A11 MF: TGTTTAGGGTTGGGAAGAAGTTAC 128
  MR: ATCGCAATAAACTAAAAAACCTACG  
  UF: TGTTTAGGGTTGGGAAGAAGTTAT 133
  UR: AATAAATCACAATAAACTAAAAAACCTACA  
TUB MF: TGGTTGTTAGTTTGATTGTTGTTAC3 96
  MR: AAAACCTATTAAAATTCCCTATATTCG  
  UF: GTGGTTGTTAGTTTGATTGTTGTTAT 97
  UR: CTAAAACCTATTAAAATTCCCTATATTCA  
ALOX12B MF: TTCTCTTACCTACCTTAAACCTTCG 152
  MR: TGAGATGGAGTTTCGTGTTTTC  
  UF: TTCTCTTACCTACCTTAAACCTTCA 154
  UR: AGTGAGATGGAGTTTTGTGTTTTT  
WNT10B MF: TGGGGTGTATAGGTAAAGGTAAATC 91
  MR: GAAAATAAATCAAACGAAAACACG  
  UF: TGGGGTGTATAGGTAAAGGTAAATT 93
  UR: TCAAAAATAAATCAAACAAAAACACA  
qRT-PCR
GENE Primer sequence Amplicon size (bp)
ALOX12B F: ACCCGAGGGCAAGATGAT 74
  R: GCAGGAAGATGGGGCAAT  
SLC6A11 F: AGGGGGTACCCATTGCTG 65
  R: CTTGGGGTACGCAATAAAGG  
TUB F: TCCGACTGGATTCCCTACAG 109
  R: GGCGCTTCTTCTTCTGCTT  
WNT10B F: GCGAATCCACAACAACAGG 107
  R: TCCAGCATGTCTTGAACTGG  
  1. 1MF, methylated forward primer; MR, methylated reverse primer; UF, unmethylated forward primer; UR, unmethylated reverse primer; F, forward primer; R, reverse primer.
  2. 2 Size of the amplification product in base pairs.
  3. 3 Underlined text represent locked nucleic acid (LNA)-modified nucleotides.