Skip to main content

Table 2 Primer sequences for RT-qPCR analysis

From: Circulating exosomal hsa_circRNA_0039480 is highly expressed in gestational diabetes mellitus and may be served as a biomarker for early diagnosis of GDM

circRNAs Primer sequences for RT-qPCR (5’ to 3’)
hsa_circ_0039480 S: ATGCCCTGAAGAACCGCAG
AS: TATCCAGAGAGCTTCGACCAG
hsa_circ_0091803 S: ATAGTGCGATGTCGTTTTGTGC
AS: CAGAATGGACACAGGGAGGTC
hsa_circ_0034543 S: ACCTATGCTGGTGGTAGACT
AS: CAGCCTATGTGACGAGGGTC
hsa_circ_0067789 S: CCCATCACAATGACACAGAGC
AS: TCAGGCCGTAAAGTACCTTGG
hsa_circ_0059639 S: AAACCTTTGTGGCTGTGGTTG
AS: AGTCAAGGAAACACGCTGCC
hsa_circ_0057036 S: AGGTCCCTGCTGAATCACACG
AS: CTGAGGCGGTGGGGTAAC
hsa_circ_0049861 S: GTGCGGAGGTGTCTGAACTAA
AS: TTCCTGAGCCCTGTCCAACT
hsa_circ_0086841 S: GCCCCAAACAGGTCATGCT
AS: GTGTTCTGTGGTTGCCTCCAG
hsa_circ_0049763 S: ACTCATTGTAAGTTGCCACTGC
AS: TCCAGATGGTTCAACAGCTCA
hsa_circ_0026642 S: GCTAGTCAGTGTGGCTCTCTC
AS: GGGTCCAGCCAAAGTGATAA
hsa_circ_0065642 S: TGGCACTCAGTCTCTCTTCTCT
AS: GCCAACTCTACCTGCTTTCCA
hsa_circ_0013653 S: TCAACAGACCGACGTGACAAA
AS: AACTTTGATGCGTCCTGGCA
hsa_circ_0006138 S: TGCCCGAGTGGTAAAAGACA
AS: GTCCAATCTGGCTAAAGAGTTGC
hsa_circ_0025937 S: ACAAGCCCGACCAGAATACG
AS: ACTCCGGGGTTCGAAAATCA
hsa_circ_0026497 S: CAGACAGCTTTGATGACTACCC
AS: GAAACATAGGTGCTTCCTCCAC