Skip to main content

Table 1 Primer sequences used in RT-qPCR assay were listed

From: CircSERPINA3 regulates SERPINA3-mediated apoptosis, autophagy and aerobic glycolysis of prostate cancer cells by competitively binding to MiR-653-5p and recruiting BUD13

Gene name Primer sequences
circSERPINA3 F:GGACGAGTCGGGAACCAGAG
R:CAGGGAATCGCTGTCACCTTC
SERPINA3 F:CCTGAGGCAGAGTTGAGAATG
R:TCAGGGGCCTTCAGGACTAA
miR-653-5p F:CCGAGgtgttgaaacaatct
R:TCAACTGGTGTCGTGGA
miR-3164 F:CCGAGtgtgactttaagggaa
R:TCAACTGGTGTCGTGGA
miR-6820-3p F:CCGAGtgtgacttctcccctg
R:TCAACTGGTGTCGTGGA
miR-509-3p F:CCGAGtgattgacatttctg
R:TCAACTGGTGTCGTGGA
miR-5586-5p F:CCGAGtatccagcttgttact
R:TCAACTGGTGTCGTGGA
GEMIN2 F:GTCCGCAGTGGAAGAGTTGA
R:CAGGTATTCCTGAGGCGTCC
MARCH2 F:AGGGTCTTTGTGGCTTGAGG
R:GTGACCTGGGTGACGTACTG
NFIA F:AGCTCATGGAGCGGCAATAG
R:CATCCTGGGTGAGACAGAGC
ADSS F:CTCGGAGTGGACTTCGGATG
R:GCTGCGTTTGCACCTTCTAC
BUD13 F:AAGGCCGAGTATCTGAAGCG
R:GCCTCCCAGAAGCTTCCATT
β-actin F:CTAAGGGGGCGCTCTGTCG
R:GCGTAGAGGTCCTTCCTGATG
U6 F:TCCCTTCGGGGACATCCG
R:AATTTTGGACCATTTCTCGATTTGT