Skip to main content

Table 1 Primers for quantitative RT-PCR

From: Urinary small extracellular vesicles derived CCL21 mRNA as biomarker linked with pathogenesis for diabetic nephropathy

Primer Forward (5′–3′) Reverse (5′–3′)
Homo CCL-2 CCTTCATTCCCCAAGGGCTC GGTTTGCTTGTCCAGGTGGT
Homo CCL-5 CGCTGTCATCCTCATTGCTA CCAGACTTGCTGTCCCTCTC
Homo CCL-21 AGAGAGACCGAGGAGGGAGA TTTGGGTGGGAAGACAGAAC
Homo CCL-22 CTGTTCCCATCAGCGATTCC GACCCAGAAGTGGGATGTGT
Homo CXCL-1 ACTCAAGAATGGGCGGAAAG TCCTAAGCGATGCTCAAACA
Homo CXCL-2 CTCAAGAATGGGCAGAAAGC AAACACATTAGGCGCAATCC
Homo CCR2 CGGTGCTCCCTGTCATAAAT CCCAAAGACCCACTCATTTG
Homo IL-10 CCACGCTTTCTAGCTGTTGA CTCCGAGACACTGGAAGGTG
Homo IL-18 CAGACCTTCCAGATCGCTTC ATAGAGGCCGATTTCCTTGG
Homo IL-22 AGGCTCAGCAACAGGCTAAG TTCAGCTTTGCTCTGGTCAA
Homo IFN-γ AACTAGGCAGCCAACCTAAGC AAGCACCAGGCATGAAATCT
Homo IL-1β GCATCCAGCTACGAATCTCC TCGTTATCCCATGTGTCGAA
Homo IL-6 CCTTCCAAAGATGGCTGAAA AGCTCTGGCTTGTTCCTCAC
Homo TNFα CCCAGGGACCTCTCTCTAATC TGAGGTACAGGCCCTCTGAT
Homo GAPDH CTCTGCTCCTCCTGTTCGAC GCGCCCAATACGACCAAATC