Skip to main content

Table 1 PCR primer sequences

From: Expression profiles and functional prediction of long non-coding RNAs LINC01133, ZEB1-AS1 and ABHD11-AS1 in the luminal subtype of breast cancer

Genes Forward (5′–3′) Reverse (5′–3′)
β2M AGATGAGTATGCCTGCCGTG GCGGCATCTTCAAACCTCCA
LINC01133 GGGGAGAGTAGGTGAAAAGATGA GCTGGACTTTGGAGAACTTTGC
ZEB1-AS1(T5,6)a TGCATGAAGGTGGTATGGACT GGGGTAGGAATAGGGATAACTGT
ZEB1-AS1(T1-4)a CCTGTACCTCCCTGCTAAGC GCCCAAACTAACTAAACCAGAAAC
ABHD11-AS1 CTCCAGGAACGGGATGAAG CAGCCTCAGTTTCTCCTCCA
  1. β2M Beta-2-Microglobulin, PCR polymerase chain reaction
  2. aTwo pairs of primers, namely ZEB1-AS1(T5,6) and ZEB1-AS1(T1-4), were designed to evaluate the expression level of different transcript variants of lncRNA ZEB1-AS1