Skip to main content

Table 1 Primer and probe sequences

From: Droplet digital PCR allows vector copy number assessment and monitoring of experimental CAR T cells in murine xenograft models or approved CD19 CAR T cell-treated patients

Primers/probes Name Orientation 5′–3′ Sequence Target area PCR/Size of product (bp) Targeted CAR/Genomic DNA
CAR Primers CD28j Fw CACGTCTCTTGTCCAAAACATC Junction CD28/CD3z 28z/137 axi-cel; experimental CS1
41BB Fw GAAGAAGAAGAAGGAGGATGTG 41BB 41BBz/145 tisa-cel; experimental IL-1RAP
CD3z R CTTCGCAGCCTATCGCTCCAG CD3z   Common to all CARs
Probe [Fam/BHQ] pCAR Fw CCCGCGTACCAGCAGGGCCAGA CD3z   Common to all CARs
Reference Primers fGAPDH Fw ACATCATCCCTGCCTCTAC GAPDH GAPDH/179 Genomic DNA GAPDH specific
rGAPDH R CTGCTTCACCACCTTCTTG
Probe [Hex/BHQ] pGAPDH Fw CACTGCCAACGTGTCAGTGGTGGACCT GAPDH