Skip to main content

Table 2 Sequences of short hairpin RNAs

From: A circular RNA derived from PLXNB2 as a valuable predictor of the prognosis of patients with acute myeloid leukaemia

Gene Sequence (5′-3′)
circPLXNB2 shRNA-1 CATCCTGGGATCCTATGTCTG
circPLXNB2 shRNA-2 ACATCCTGGGATCCTATGTCT
circPLXNB2 shRNA-3 GACATCCTGGGATCCTATGTC
shRNA-NC GATCATACGTGCGATCAGA
  1. shRNA short hairpin RNAs, NC negative control. CircPLXNB2 shRNA-1 was confirmed to have the best interference effect by qRT-PCR, so this sequence was selected to construct circPLXNB2 knockdown lentivirus vector