Skip to main content

Table 1 Primers used for qRT-PCR

From: A circular RNA derived from PLXNB2 as a valuable predictor of the prognosis of patients with acute myeloid leukaemia

Gene Primer Sequence (5′-3′)
circPLXNB2-F CCCACGTCAAAGGTCAAG
circPLXNB2-R TCTCCTCCTCCCATCTCG
has_circ_0004520-F TGAGACCAAGAAGGAGAAAAGAAAA
has_circ_0004520-R CTCGCACATCGAAGAGGTCA
PLXNB2-F GCATCCGCATCACCATCC
PLXNB2-R GGCCCAGTTTCCCGAAGA
GAPDH-F GACCTGACCTGCCGTCTAG
GAPDH-R AGGAGTGGGTGTCGCTGT
  1. F Forward primer, R Reversed primer, GAPDH glyceraldehyde 3-phosphate dehydrogenase