Skip to main content

Table 2 Primer sequences

From: Insulin treatment improves liver histopathology and decreases expression of inflammatory and fibrogenic genes in a hyperglycemic, dyslipidemic hamster model of NAFLD

Gene ID Forward primer Reverse primer
Gpnmb TTGCGCAAGTGAAAGACATC CCAGTGTTGTCCCCAAAGTT
Pklr TGACCTAGTTACCCGCAACC CAGGGCGTCTTAGAATCCAG
Spp1 ACAGCCAGGATTCTGTGGAC TTTGCCCGTAGTCCATAAGC
Soat1 GAGCAAGATCAAGCCCAGAG TCGTCGAGAATGGAGAAGGT
Ccl2 CAGAGAGACTCAGGCCAACC AGCAGGTGAGTGGGGAGTTA
Il- GCAGGTGGTGTCAGTCATTG AGACAGCACGAGGCATTTCT
Col3a1 CTTTGTGCAAAGTGGGACCT TCTCCAAATGGGATCTCTGG
Timp-1 TCCCTTGCAAACTGGAGAGT GGGTAGGCTTTGGGTCATTT
Housekeeping genes
Hprt1 TGATCAGTCAACAGGGGACA AGAGGTCCTTTTCACCAGCA
Rpl18 AGAACAAGACTGCCGTGGTT GGTATACCTCTCGGCCCTTC