Skip to main content

Table 1 Primer sequences for RT-qPCR reaction

From: Reduction of miR-744 delivered by NSCLC cell-derived extracellular vesicles upregulates SUV39H1 to promote NSCLC progression via activation of the Smad9/BMP9 axis

Targets Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
miR-744 AATGCGGGGCTAGGGCTA GTGCAGGGTCCGAGGT
U6 CGGGTTTGTTTTGCATTTCT AGTCCCAGCATGAACAGCTT
SUV39H1 TGCGTATCCTCAAGCAGTTCC CCGTCCAGGTCCACCTCATTC
GAPDH CGGATTTGGTCGTATTG GAAGATGGTGATGGGATT
Smad9 CTTTCCAGCAGCCTCCGTGC GGGGTGGTGTGTCAACTGAGTG
BMP4 TAGTCCCAAGCATCACCC TCTCAGCGGCATCCAC