Skip to main content

Table 2 Primer sequences for RT-qPCR

From: Extracellular vesicle-encapsulated microRNA-424 exerts inhibitory function in ovarian cancer by targeting MYB

Gene Primer sequence (5′-3′)
miR-424 Forward: GGCAGCAGCAATTCATG
Reverse: CAGTGCGTGTCGTGGAGT
MYB Forward: AGAAACGAGCCTGCCTGCCTTACA
Reverse: AGATGGTTCCTCAGGGAGGT
cel-miR-39 UCACCGGGUGUAAAUCAGCUUG
U6 Forward: CAGGGGCCATGCTAAATCTTC
Reverse: CTTCGGCAGCACATATACTAAAAT
GAPDH Forward: CTCATGACCACAGTCCATGCCA
Reverse: GGATGACCTTGCCCACAGCCTT
  1. RT-qPCR reverse transcription quantitative polymerase chain reaction, miR microRNA, GAPDH glyceraldehyde-3-phosphate dehydrogenase