Skip to main content

Table 1 Primer sequences used for RT-qPCR

From: RETRACTED ARTICLE: microRNA-128 mediates CB1 expression and regulates NF-KB/p-JNK axis to influence the occurrence of diabetic bladder disease

Targets Forward primer (5′–3′) Reverse primer (5′–3′)
miR-128 CAGATCGTCACAGTGAACC \
CB1 CGTCTGAGGATGGGAAGGTA TCTTGACCGTGCTCTTGATG
GADPH CTTCACCACCATGGAGAAGGC GGCATGGACTGTGGTCATGAG