Skip to main content

Table 2 The primer sequence used in ChIP-qPCR

From: Graphene oxide suppresses the growth and malignancy of glioblastoma stem cell-like spheroids via epigenetic mechanisms

GENEForward primerReverse primer
GFAP#1(ChIP)TTGGAAAGCAGGTCAGAGGGGTGGCTCATGCTTGTAATC
GFAP#2(ChIP)GACTCACCTTGGCACAGACATAGAGCCTTGTTCTCCACC
TUJ1#1(ChIP)CCTGGGAAATGCTTGATGTCAGAGGAAATGGAGGTGGTC
TUJ1#2(ChIP)GGGGAACGGAGGAGGACATCATTGGAGCAGACGGAGTG