Skip to main content

Table 1 The primer sequence used in RNA based PCR

From: Graphene oxide suppresses the growth and malignancy of glioblastoma stem cell-like spheroids via epigenetic mechanisms

GENEForward primerReverse primer
SOX2ATGGGTTCGGTGGTCAAGTCCGCTCTGGTAGTGCTGGGACA
CD133AGTCGGAAACTGGCAGATAGCGGTAGTGTTGTACTGGGCCAAT
GAPDHCTGGGCTACACTGAGCACCAAGTGGTCGTTGAGGGCAATG
CDK4ATGGCTACCTCTCGATATGAGCCATTGGGGACTCTCACACTCT
CDK6TCTTCATTCACACCGAGTAGTGCTGAGGTTAGAGCCATCTGGAAA
CYCLIND1CAATGACCCCGCACGATTTCCATGGAGGGCGGATTGGAA
EZH2AATCAGAGTACATGCGACTGAGAGCTGTATCCTTCGCTGTTTCC
KDM6ATTCCTCGGAAGGTGCTATTCAGAGGCTGGTTGCAGGATTCA
KDM6BCGCTGCCTCACCCATATCCATCCGCGACCTCTGAACTCT