Skip to main content

Table 1 Primers used for RT-PCR

From: An engineering probiotic producing defensin-5 ameliorating dextran sodium sulfate-induced mice colitis via Inhibiting NF-kB pathway

Gene Primer sequences Product size (bp) GenBank accession no. Species
IL-6 F:GAGTCACAGAAGGAGTGGCTAAGGA 106 NM_031168.1 Mouse
R:CGCACTAGGTTTGCCGAGTAGATCT
TNF-α F:GCATGGTGGTGGTTGTTTCTGACGAT 99 NM_010851.2 Mouse
R:GCTTCTGTTGGACACCTGGAGACA
IL-1β F:CTCGTGCTGTCGGACCCAT 343 NM_008361.4 Mouse
R:CAGGCTTGTGCTCTGCTTGTGA
Zo-1 F:TCATCCCAAATAAGAACAGAGC 198 XM_006540786.1 Mouse
R:GAAGAACAACCCTTTCATAAGC
Occludin F:AAGCAAGTGAAGGGATCTGC 204 NM_001205255.1 Mouse
R:GGGGTTATGGTCCAAAGTCA
GAPDH F:CAACGGCACAGTCAAGGCTGAGA 112 NM_017008.3 Mouse
R:CTCAGCACCAGCATCACCCCAT
Zo-1 F:AGAGGAAGCTGTGGGTAACG 320 NM_001301025.1 Human
R:TCCTTCAGCTGGTCCTCCTT
Occludin F:CTCCCTGGCACCGTTGG 548 NM_001205254.1 Human
R:GGCCAACATGAAGCCCTTTG
β-Actin F:CTCGCCTTTGCCGATCC 258 NM_001101.3 Human
R:GGGGTACTTCAGGGTGAGGA