Skip to main content

Table 1 Primers used for RT-PCR

From: An engineering probiotic producing defensin-5 ameliorating dextran sodium sulfate-induced mice colitis via Inhibiting NF-kB pathway

GenePrimer sequencesProduct size (bp)GenBank accession no.Species
IL-6F:GAGTCACAGAAGGAGTGGCTAAGGA106NM_031168.1Mouse
R:CGCACTAGGTTTGCCGAGTAGATCT
TNF-αF:GCATGGTGGTGGTTGTTTCTGACGAT99NM_010851.2Mouse
R:GCTTCTGTTGGACACCTGGAGACA
IL-1βF:CTCGTGCTGTCGGACCCAT343NM_008361.4Mouse
R:CAGGCTTGTGCTCTGCTTGTGA
Zo-1F:TCATCCCAAATAAGAACAGAGC198XM_006540786.1Mouse
R:GAAGAACAACCCTTTCATAAGC
OccludinF:AAGCAAGTGAAGGGATCTGC204NM_001205255.1Mouse
R:GGGGTTATGGTCCAAAGTCA
GAPDHF:CAACGGCACAGTCAAGGCTGAGA112NM_017008.3Mouse
R:CTCAGCACCAGCATCACCCCAT
Zo-1F:AGAGGAAGCTGTGGGTAACG320NM_001301025.1Human
R:TCCTTCAGCTGGTCCTCCTT
OccludinF:CTCCCTGGCACCGTTGG548NM_001205254.1Human
R:GGCCAACATGAAGCCCTTTG
β-ActinF:CTCGCCTTTGCCGATCC258NM_001101.3Human
R:GGGGTACTTCAGGGTGAGGA