Skip to main content

Table 1 Primers were shown for qPCR

From: CircRNA expression profiles in human dental pulp stromal cells undergoing oxidative stress

Gene Primer Annealing temperature (°C) Product length (bp)
GAPDH (human) F:5′GGGAAACTGTGGCGTGAT3′
R:5′GAGTGGGTGTCGCTGTTGA3′
60 299
hsa_circ_058230 F:5′TGGATGGGGAGCCCTACAAG3′
R:5′CCAGGTGCGGGTGTACAGG3′
60 94
hsa_circ_0000257 F:5′GGAGCAGACCAAGGCAGCG3′
R:5′CGTCAAAGATCACGACTGTCCC3′
60 120
hsa_circ_0061170 F:5′CCAGAAGCCAAAGATAACACC3′
R:5′ATTTGCCTGTAACTTTCGCTC3′
60 155
hsa_circ_0065217 F:5′CCATGCCAATATGTGGGTGC3′
R:5′GCCAGGAGGTTCTTGTGCC 3′
60 89
hsa_circ_0087354 F:5′CTGGAGTAGGAGTTTGGTGGTA3′
R:5′CTTCACCAGAGGATGTATTGCT3′
60 64
hsa_circ_0001949 F:5′GTGCTGATCTTCTGACATTCAGGT3′
R:5′CTGGAAGCTCAGGATTATCTGGA3′
60 154