Skip to main content

Table 1 Primer sequences and amplicon length of the genes studied by qRT-PCR

From: Plasma peroxiredoxin changes and inflammatory cytokines support the involvement of neuro-inflammation and oxidative stress in Autism Spectrum Disorder

Unigene accession no. Gene ID Gene Left primer Right primer Amplicon length (bp)
Hs.171189 196 AHR CTTCCAAGCGGCATAGAGAC AGTTATCCTGGCCTCCGTTT 198
Hs.274402 3303 HSPA1Aa,b CCCTGATCAAGCGCAACT CTCGTACACCTGGATCAGCA 98
Hs.654458 3569 IL6 CAATGAGGAGACTTGCCTGGT AGCTGCGCAGAATGAGATGA 275
Hs.193717 3586 IL10 GGCGCTGTCATCGATTTCTTC GCCACCCTGATGTCTCAGTT 181
Hs.126256 3553 IL1 beta AGCCATGGCAGAAGTACCTG CCTGGAAGGAGCACTTCATCT 116
Hs.673 3592 IL12A GCTCCAGAAGGCCAGACAAA GCCAGGCAACTCCCATTAGT 183
Hs.201978 5742 PTGS1b AGCTCGTAGGAGAGAAGGAGAT AGTGTGGCCGTCTTGACAAT 253
Hs.196384 5743 PTGS2b CAAATTGCTGGCAGGGTTGC AGGGCTTCAGCATAAAGCGT 139
Hs.432121 7001 PRDX2 ACGAGCATGGGGAAGTTTGT GCCTTTCCTGGGTCAGCATA 201
Hs.502823 25824 PRDX5 TCTTTGGGAATCGACGTCTC ATTGCAGAAATCTGGCCAAC 229
Hs.463059 6774 STAT3 CGGAGAAGCATCGTGAGTGA CTCTTCCAGTCAGCCAGCTC 95
Hs.241570 7124 TNF-alpha CCCCAGGGACCTCTCTCTAA TCTCAGCTCCACGCCATT 172
Hs.520640 60 Actin-betac TGTGGCATCCACGAAACTAC TGATCTTGATCTTCATTGTGCT 175
Hs.544577 2597 GAPDHc GGCCTCCAAGGAGTAAGACC CTGTGAGGAGGGGAGATTCA 130
  1. aThese primers recognize also HSPA1B, a minor isoform of HSPA1A
  2. bHSPA1A, protein name HSP70, inducible form; PTGS1 and PTGS2, protein name COX1 and COX2 (CICLOOXYGENASE 1 AND 2)
  3. cActin-beta and GADPH were the housekeeping genes utilized in the gene expression study