Skip to main content

Table 1 Primer sequences for qRT-PCR

From: The biological behavior optimization of human periodontal ligament stem cells via preconditioning by the combined application of fibroblast growth factor-2 and A83-01 in in vitro culture expansion

Gene Forward primer (5′-3′) Reverse primer (5′-3′)
GAPDH GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA
ALP ATGGGATGGGTGTCTCCACA CCACGAAGGGGAACTTGTC
RunX2 TCCACACCATTAGGGACCATC TGCTAATGCTTCGTGTTTCCA
OPN TCCTAGCCCCACAGACCCTT CACACTATCACCTCGGCCAT
c-Myc CCCGCTTCTCTGAAAGGCTCTC CTCTGCTGCTGCTGCTGGTAG
Nanog CAGAAGGCCTCACACCTAC ATTGTTCCAGGTCTGGTTGC