Skip to main content

Table 1 Sequences of primers used for Real-Time PCR

From: In vitro effects of interleukin (IL)-1 beta inhibition on the epithelial-to-mesenchymal transition (EMT) of renal tubular and hepatic stellate cells

  Forward 5′-3′ Reverse 5′-3′
Gapdh ACACCCACTCCTCCACCTTT TCCACCACCCTGTTGCTGTA
Mmp-2 GCGGCGGTCACAGCTACTT CACGCTCTTCAGACTTTGGTTCT