Skip to main content

Table 2 Primer sequences of AP-1 transcription factors for RT-qPCR analysis

From: Identification of a novel role of IL-13Rα2 in human Glioblastoma multiforme: interleukin-13 mediates signal transduction through AP-1 pathway

1. c-Jun FW: GAAACGACCTTCTATGAC
BW: GGTTACTGTAGCCATAAG
2. Fra-1 FW: AGCAGAAGTTCCACCTGG
BW: AATGAGGCTGTACCATCCA
3. JunD FW: AGCTCACAGTTCCTCTAC
BW: TTCTGCTTGTGTAAATCC
4. c-Fos FW: AGACCAACTAGAAGATGAGAA
BW: CTGCCAGGATGAACTCTA
5. JunB FW: TACCACGACGACTCATAC
BW: GGTTTCAGGAGTTTGTAGT
6. β-actin FW: AAATCTGGCACCACACCTTC
BW: GGGGTGTTGAAGGTCTCAAA