Skip to main content

Table 2 Primer sequences of circRNA and mRNA measured by qRT-PCR

From: Circular RNA regulatory network reveals cell–cell crosstalk in acute myeloid leukemia extramedullary infiltration

ID Primer sequence Product length (bp)
Forward (5′–3′) Reverse (5′–3′)
β-actin(H) GTGGCCGAGGACTTTGATTG CCTGTAACAACGCATCTCATATT 73
hsa_circRNA_004520 TGAGACCAAGAAGGAGAAAAGAAAA CTCGCACATCGAAGAGGTCA 145