Fig. 1
From: Targeted deletion of Insm2 in mice result in reduced insulin secretion and glucose intolerance
Genotyping and characterization of Insm2−/− mice. a Targeted deletion of 25-bp (c.108_132delAGTCCCCGACCGGGCTCCTCCGGTG) in the coding sequence region (CDS) of Insm2 (GenBank acc. no., NM_020287.2). b Sanger chromatograms show the target sequence regions in wild-type (WT), heterozygous (HET), and homozygous (HO) Insm2−/− mice. c Quantitative RT-PCR analysis indicates that Insm2 mRNA is markedly decreased in the Insm2−/− mouse brain as compared to normal controls. d Western blotting shows no detectable INSM2 protein in Insm2−/− mouse brain tissues. e, f H&E staining reveals no significant structure alterations in Insm2−/− mouse pancreatic islets