Skip to main content

Table 2 List of the sequence of human gene primers

From: Plasma interleukin-37 is increased and inhibits the production of inflammatory cytokines in peripheral blood mononuclear cells in systemic juvenile idiopathic arthritis patients

Gene name Forward (5′–3′) Reverse (5′–3′)
IL-37 AGTGCTGCTTAGAAGACCCGG AGAGTCCAGGACCAGTACTTTGTGA
TNF-α ACCTCTCTCTAATCAGCCCTCT GGGTTTGCTACAACATGGGCTA
IL-1β CCACAGACCTTCCAGGAGAAT GTGCACATAAGCCTCGTTATCC
IL-6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG
IL-17 ACCTCATTGGTGTCACTGCTAC GTTCAGGTTGACCATCACAGTC
β-actin CCTGACTGACTACCTCATGAAG GACGTAGCACAGCTTCTCCTTA