Skip to main content

Table 2 Mature miRNA primer sequence used for q RT PCR

From: Screening and identification of potential novel biomarker for diagnosis of complicated Plasmodium vivax malaria

S. No Gene Forward primer (5′-3′)
1 hsa-miR-7977 TTCCCAGCCAACGCACCA
2 hsa-miR-28-3p CACTAGATTGTGAGCTCCTGGA
3 hsa-miR-378a-5p CTCCTGACTCCAGGTCCTGTGT
4 hsa-miR-194-5p TGTAACAGCAACTCCATGTGGA
5 hsa-miR-3667-5p AAAGACCCATTGAGGAGAAGGT
6 hsa-miR-3651 CATAGCCCGGTCGCTGGTACATGA
7 hsa-miR-192-5p CTGACCTATGAATTGACAGCC
8 hsa-miR-19b-3p TGTGCAAATCCATGCAAAACTGA
9 hsa-miR-181b-5p AACATTCATTGCTGTCGGTGGGT
10 hsa-miR-29a-3p TAGCACCATCTGAAATCGGTTA
11 hsa-miR-200c-3p TAATACTGCCGGGTAATGATGGA
12 hsa-miR-155-5p TTAATGCTAATCGTGATAGGGGT